Small RNAs from Arabidopsis plants infected with CMV-?2b
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
SUBMITTER: JUAN JOVEL
PROVIDER: E-GEOD-27477 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:We report that CMV2b exist in a complex of sRNAs in arabidopsis, with significant preference to repeat-associated AGO4-related 24nt siRNAs. This differential selection of siRNAs in vivo helps CMV 2b to perturb host epigenetic defense in the form of transposons activation and severeal repeat associated loci hypomethylation. Examination of CMV 2b presence in sRNAs complex in vivo
2013-01-18 | E-GEOD-23771 | biostudies-arrayexpress
Project description:We investigated the role of A. thaliana RDRs in the RNAi-mediated viral immunity by using a mutant of cucumber mosaic virus (CMV) that does not express the VSR protein 2b. CMV contains three positive-strand genomic RNAs and the 2b protein encoded by RNA2 is essential for infection by suppressing antiviral silencing initiated by either DCL4 or DCL2. Our results demonstrate an essential role for the amplification of viral siRNAs by either RDR1 or RDR6 in antiviral silencing. Further analyses, including Illumina sequencing of more than 3.5 million viral siRNAs, indicated target specificity of the two antiviral RDRs.
2010-01-20 | GSE19965 | GEO
Project description:Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis This study constructed and sequenced two independent small RNA libraries from the upper uninoculated leaves of (i) WT Arabidopsis plants 14 d after mock inoculation and of (ii) rdr1 rdr6 plants 14 d after infection with Fny CMV-Δ2b, and one library each from the upper uninoculated leaves of (iii) WT, (iv) rdr1, and (v) rdr6 plants 14 d after infection with TuMV-GFP. Coimmunoprecipitation with FLAG- and HA-specific antibodies was used to obtain (vi,vii) AGO1 and (viii,ix) AGO2 complexes, respectively, from the FLAG-AGO1/ago1-36 and HA-AGO2 plants 14 d after infection with Fny CMV-Δ2b for extracting total loaded small RNAs for the construction and sequencing of small RNA libraries.
2014-08-30 | E-GEOD-60929 | biostudies-arrayexpress
Project description:We focused our analyses on the description of viral (CMV-∆2b) and, based on genetic and molecular evidence, classified them and discussed their relevance in antiviral defense.
2012-03-01 | GSE27477 | GEO
Project description:We constructed two independent small RNA libraries from leaves of mock and Cucumber mosaic virus (CMV) infected tomatoes, respectively, and sequenced with a high-throughput Illumina Solexa system. Based on sequence analysis and hairpin structure prediction, a total of 50 known miRNAs (32 families) and 568 potentially candidate miRNAs (PC-miRNAs) were firstly identified in tomato, with 12 known miRNAs and 154 PC-miRNAs supported by both the 3p and 5p strands. Comparative analysis revealed 79 miRNAs (including 15 novel tomato miRNAs) and 40 PC-miRNAs were differentially expressed between the two libraries. Among these virus responsive miRNAs, expression patters of some novel tomato miRNAs and PC-miRNAs in mock and in CMV-Fny infected tomatoes were further validated by qRT-PCR. Moreover, we revealed 563 potential targets for 66 tomato miRNAs by the recently developed degradome sequencing approach, including 124 targets for 7 new tomato miRNAs and 97 targets for 24 PC-miRNAs. Target annotation for the newly identified miRNA and PC-miRNAs indicated that they were involved in multiple biological processes, including transcriptional regulation and virus resistance. Gene ontology analysis of these target transcripts demonstrated that stress response- and photosynthesis-related genes were most affected in CMV-Fny infected tomatoes. Examination of small RNAs and their targets in mock and CMV-Fny infected tomatoes.
2014-10-20 | E-GEOD-56974 | biostudies-arrayexpress
Project description:In the present study, we discovered an unexpected interplay between immunometabolism and antiviral immunity. Profiling of human bronchial epithelial BEAS-2B cells was performed using Agilent’s SurePrint G3 human gene expression microarray kit. A single-color design provided two types of comparison: (i) IAV-infected versus mock-infected cells, and (ii) succinate-treated infected cells versus mock-infected cells.
2022-02-17 | E-MTAB-10031 | biostudies-arrayexpress
Project description:Analysis of global gene expression profiles of flow cytometry-sorted, different pathogen-specific CD4+ T cell populations from the same peripheral blood mononuclear cells (PBMC), to identify molecular parameters that regulate differential susceptibilities of these CD4+ T cells to HIV infection. The results reveal distinct gene expression profiles between CMV-specific and tetanus toxoid/Candida-specific CD4+ T cells that involved selective upregulation of comprehensive innate antiviral Total RNA extracted from CFSE-low, flow-sorted pathogen-specific CD4+ T cells were analyzed for global gene expression. Changes in gene expression were compared between CMV to combined TT/Candida, or TT/CMV and Candida/CMV.
2012-12-13 | E-GEOD-42853 | biostudies-arrayexpress
Project description:The cucumber mosaic virus (CMV) 2b counter-defense protein disrupts plant antiviral mechanisms mediated by RNA silencing and salicylic acid (SA). Using NASC ATH-1 microarrays to investigate defensive gene expression in 2b-transgenic Arabidopsis thaliana plants we found that, surprisingly, 2b inhibited expression of few SA-regulated genes and in some instances enhanced the effect of SA on certain genes. Strikingly, the 2b protein inhibited changes in the expression of 90% of genes regulated by jasmonic acid (NASCARRAYS-415: Lewsey et al. Molec. Plant-Microbe Interact. vol. 23, in press). We will extend this work to understand the effects of the 2b protein on plant gene expression during an authentic viral infection. By comparing the effects on the transcriptome of infection by wild-type CMV and the 2b gene deletion mutant, CMVâËâ 2b, we will reveal not only the influence of the 2b protein but also the effects of its interactions with other viral gene products (and the process of infection itself), on the host transcriptome. 9 samples were used in this experiment
2012-05-14 | E-GEOD-37921 | biostudies-arrayexpress
Project description:The cucumber mosaic virus (CMV) 2b counter-defense protein disrupts plant antiviral mechanisms mediated by RNA silencing and salicylic acid (SA). Using NASC ATH-1 microarrays to investigate defensive gene expression in 2b-transgenic Arabidopsis thaliana plants we found that, surprisingly, 2b inhibited expression of few SA-regulated genes and in some instances enhanced the effect of SA on certain genes. Strikingly, the 2b protein inhibited changes in the expression of 90% of genes regulated by jasmonic acid (NASCARRAYS-415: Lewsey et al. Molec. Plant-Microbe Interact. vol. 23, in press). We will extend this work to understand the effects of the 2b protein on plant gene expression during an authentic viral infection. By comparing the effects on the transcriptome of infection by wild-type CMV and the 2b gene deletion mutant, CMVâËâ 2b, we will reveal not only the influence of the 2b protein but also the effects of its interactions with other viral gene products (and the process of infection itself), on the host transcriptome.
2012-05-15 | GSE37921 | GEO
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress