Novel Targets of the Transcription Factor Sox9 in Neonatal Mouse Limb
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
SUBMITTER: Joy Lincoln
PROVIDER: E-GEOD-29058 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Sox9 is an SRY-related transcription factor required for expression of cartilaginous matrix genes in the developing skeletal system and heart valve structures. In contrast to positively regulating formation of cartilaginous matrix, Sox9 has also been shown to negatively regulate matrix mineralization associated with bone formation. While the transcriptional activation of Sox9 target genes during chondrogenesis has been well studied, the mechanisms by which Sox9 represses osteogenic processs are not so clear. To address this, we performed a genome-wide Sox9 ChIP-on-chip approach using neonatal mouse lim tissue.
2011-11-01 | GSE29058 | GEO
Project description:Nuclear and cytoplasmic RNA were extracted by hypotonic cell lysis from D.-mel2 cell knock down by RNAi against dU2AF50 or with non-specific dsRNA.
2007-07-05 | E-GEOD-1344 | biostudies-arrayexpress
Project description:Introduction: In addition to the well-known cartilage extracellular matrix-related expression of Sox9, we demonstrated that chondrogenic differentiation of progenitor cells is driven by a sharply defined bi-phasic expression of Sox9: an immediate early and a late (extracellular matrix associated) phase expression. In this study we aimed to determine what biological processes are driven by Sox9 during this early phase of chondrogenic differentiation. Materials: Sox9 expression in ATDC5 cells was knocked-down by siRNA transfection at the day before chondrogenic differentiation or at day 6 of differentiation. Samples were harvested at 2 hours, and 7 days of differentiation. The transcriptomes (RNA-seq approach) and proteomes (Label-free proteomics approach) were compared using pathway and network analyses. Total protein translational capacity was evaluated with the SuNSET assay, active ribosomes with polysome profiling and ribosome modus with bicistronic reporter assays. Results: Early Sox9 knockdown severely inhibited chondrogenic differentiation weeks later. Sox9 expression during the immediate early phase of ATDC5 chondrogenic differentiation regulated the expression of ribosome biogenesis factors and ribosomal protein subunits. This was accompanied by decreased translational capacity following Sox9 knockdown, and this correlated to lower amounts of active mono- and polysomes. Moreover, cap- versus IRES-mediated translation was altered by Sox9 knockdown. Sox9 overexpression was able to induce reciprocal effects to the Sox9 knockdown. Conclusion: Here we identified an essential new function for Sox9 during early chondrogenic differentiation. A role for Sox9 in regulation of ribosome amount, activity and/or composition may be crucial in preparation for the demanding proliferative phase and subsequent cartilage extracellular matrix-production of chondroprogenitors in the growth plate in vivo.
2021-06-18 | PXD024715 | Pride
Project description:The formation of cartilaginous organoids fostered by the cell–hydrogel adaptation creates a hypoxic microenvironment and induces metabolic switching to favor glycolysis and the accumulation of lactate in the MSC spheroids, leading to significantly elevated histone lysine lactylation (Kla). We further show that the increased H3K18la enhances chondrogenesis and cartilaginous matrix deposition by regulating the transcriptional accessibility of chondrogenic genes.
2025-03-26 | GSE280956 | GEO
Project description:Vascular calcification and increased extracellular matrix (ECM) stiffness are hallmarks of vascular ageing. Sox9 (SRY-Box Transcription Factor 9) is a master regulator of chondrogenesis, also expressed in the vasculature, that has been implicated in vascular smooth muscle cell (VSMC) osteo-chondrogenic conversion. Here, we investigated the relationship between vascular ageing, calcification and Sox9-driven ECM regulation in VSMCs. Immunohistochemistry in human aortic samples showed that Sox9 was not spatially associated with vascular calcification but correlated with the senescence marker p16. Analysis of Sox9 expression in vitro showed it was mechanosensitive with increased expression and nuclear translocation in senescent cells and on stiff matrices. Manipulation of Sox9 via overexpression and depletion, combined with atomic force microscopy (AFM) and proteomics, revealed that Sox9 regulates ECM stiffness and organisation by orchestrating changes in collagen expression and reducing VSMC contractility, leading to the formation of an ECM that mirrored that of senescent cells. These ECM changes promoted phenotypic modulation of VSMCs whereby senescent cells plated onto ECM synthesized from cells depleted of Sox9 returned to a proliferative state, while proliferating cells on a matrix produced by Sox9 expressing cells showed reduced proliferation and increased DNA damage, reiterating features of senescent cells. Procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (LH3) was identified as a Sox9 target, and key regulator of ECM stiffness. LH3 is packaged into extracellular vesicles (EVs) and Sox9 promoted EV secretion, leading to increased LH3 deposition within the ECM. These findings identify cellular senescence and Sox9 as a key regulators of ECM stiffness during VSMC ageing and highlight a crucial role for ECM structure and composition in regulating VSMC phenotype. We identify a positive feedback cycle whereby cellular senescence and increased ECM stiffening promote Sox9 expression which drives further ECM modifications that act to accelerate vascular stiffening and cellular senescence.
2024-06-16 | PXD046001 | Pride
Project description:Maternal gut microbiome-induced IgG regulates neonatal gut microbiome and immunity: IgG+ and IgG- bacteria
| PRJNA823359 | ENA
Project description:Transcription factor SOX9 is essential for the differentiation of chondrocytes and the development of testes. Heterozygous point mutations and genomic deletions involving SOX9 lead to campomelic dysplasia (CD) often associated with sex reversal. Chromosomal rearrangements with breakpoints mapping up to 1.3 Mb up- and downstream to SOX9, and likely disrupting its distant cis-regulatory elements, have been described in patients with milder forms of CD. Performing chromosome conformation capture-on-chip (4C) analysis in Sertoli cells and lymphoblasts we identified several novel potentially cis-interacting regions both up- and downstream to SOX9, with some of them overlapping lncRNA genes preferentially expressed in testes. Custom designed 3x720K tiling microarrays covering 4 Mb region (chr17:68,117,161-72,122,560) flanking SOX9 gene of interest
2013-09-08 | E-GEOD-50449 | biostudies-arrayexpress
Project description:Sox9 is a transcription factor expressed in most solid tumors. However, the molecular mechanisms underlying Sox9 function during tumorigenesis remain unclear. Here, using a genetic mouse model of basal cell carcinoma (BCC), the most frequent cancer in human, we show that Sox9 is expressed from the earliest step of tumor formation in a Wnt/β-catenin dependent manner. Deletion of Sox9 together with the constitutive activation of Hedgehog (HH) signaling completely prevents BCC formation and leads to a progressive loss of oncogene expressing cells. Transcriptional profiling of oncogene expressing cells with Sox9 deletion, combined with in vivo ChIP-sequencing uncovers a cancer-specific gene network regulated by Sox9 that promotes stemness, extracellular matrix (ECM) deposition and cytoskeleton remodeling while repressing epidermal differentiation. Our study identifies the molecular mechanisms regulated by Sox9 that links tumor initiation and invasion. Sox9 ChIP-seq analysis in K14CreER SmoM2 cells.
2015-05-13 | E-GEOD-68755 | biostudies-arrayexpress
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâ??s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. ChIP-chip was performed following the protocols described before [Lian Z, et al.,Genome Res. 18: 1224, 2008] with slight modifications. Briefly, 3X10^8 BL2 cells were cross-linked in 1% formaldehyde for 10 mins at room temperature and then the cells were lysed in RIPA buffer(0.1% SDS) containing protease inhibitors(Roche Inc) . Cell suspensions were sonicated under ice-cold conditions using a Branson 250 Sonifier (Branson, Danbury, CT) with a power setting 60%, fifteen 30-sec pulses on ice to shear the chromatin to a size of approximately 300-500b. Anti-IRF4 antibody (sc6059 Santa Cruz Biotechnology, Santa Cruz, CA) or normal pre-immune mouse serum IgG as a control were added to the suspensions. The suspension was incubated at 4C rotating overnight to allow the antibodies to bind to DNA fragments. Protein G beads were added next day and incubated at 4C with gentle agitation for 1 hr. The antibodyâ??DNA complexes were eluted from the beads by 1% SDS in TE incubated at 65°C. The beads were sedemented by centrifugation, and the supernatants were incubated overnight at 65°C to reverse the cross-linking in the chromatin-protein complex. RNA contamination was eliminated by incubating the samples with 200 mg of Rnase for 1 hour at 37°C. Finally, proteinase K (400 μg of proteinase K/mL, 1X TE) was added, and the samples were incubated for 2 h at 45°C, followed by a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation to recover the DNA. Immunoprecipitated DNA was analyzed by PCR for the enriched factor binding at target sequences. In some cases we did LM-PCR, about 20-100ng of the ChIP-DNA was blunt-ended by T4 DNA polymerase (New England Biolabs, Boston MA), then ligated with pre-annealed oligonucleotide linkers (oligo-1: GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC) using T4 DNA ligase (New England Biolabs) at 16°C overnight. The ligated DNA was further amplified by PCR with oligo-1 as a PCR primer, followed by purification using the Qiaquick PCR purification kit (Qiagen). We used Nimblegen high density promoter arrays based on human genome HG17 (Nimblegen System INC. Reykjavik Iceland).Taq Mastermix (QIAGEN) was used for PCR amplification under the following reaction conditions: 5 min at 94°C, 30 cycles of 30 sec at 94°C, 30 sec at 53°C, 30 sec at 72°C, and 10 min at 72°C. PCR products were analyzed by gel electrophoresis. DNA samples to be hybridized to microarrays were labeled by random priming with nonamer oligonucleotides attached to Cy3 or Cy5 dyes. Control samples for the chromatin immunoprecipitation experiments were total genomic DNA prepared from chromatin cross-linked and precipitated by the same procedure as the test sample but with non-specific IgG.. Test samples were labeled with Cy5 and applied to the same chip as the Cy3-labeled control sample. ChIP DNA samples were randomly primed with Cy3 and Cy5 random nonomers or septamers and the labeled fragments were hybridized to the promoter arrays. Data analysis was carried out by Tilescope [Lian Z, et al.,Genome Res. 18: 1224, 2008] and Integrated Genome Browser (IGB). Nimblegen ChIP-chip data were processed by automated Tilescope analysis [Zhang ZD, et al., Genome Biol. 8: R81, 2007]. The program normalizes Cy3 and Cy5 files of the tiling array results and identifies regions with statistically significant binding enrichment. Visualization and further analysis of the data were carried out using the IGB program (http://www.affymetrix.com/partners_programs/programs/developer/tools/download_igb.affx) and Database for Annotation, Visualization and Integrated Discovery (http://david.abcc.ncifcrf.gov/summary.jsp).
2015-12-15 | E-GEOD-64268 | biostudies-arrayexpress
Project description:Nucleosomal preparations generated by micorcoccal nuclease digestion were analyzed on Affymetrix tiling arrays to determine changes in occupancy after deletion of the SNF2 gene
2011-04-08 | E-TABM-1141 | biostudies-arrayexpress