Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

IRF4, a master transcription factor, regulates genes involved in BCR signaling, antigen processing and presentation, and GC development [ChIP-chip]


ABSTRACT: Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâ??s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. ChIP-chip was performed following the protocols described before [Lian Z, et al.,Genome Res. 18: 1224, 2008] with slight modifications. Briefly, 3X10^8 BL2 cells were cross-linked in 1% formaldehyde for 10 mins at room temperature and then the cells were lysed in RIPA buffer(0.1% SDS) containing protease inhibitors(Roche Inc) . Cell suspensions were sonicated under ice-cold conditions using a Branson 250 Sonifier (Branson, Danbury, CT) with a power setting 60%, fifteen 30-sec pulses on ice to shear the chromatin to a size of approximately 300-500b. Anti-IRF4 antibody (sc6059 Santa Cruz Biotechnology, Santa Cruz, CA) or normal pre-immune mouse serum IgG as a control were added to the suspensions. The suspension was incubated at 4C rotating overnight to allow the antibodies to bind to DNA fragments. Protein G beads were added next day and incubated at 4C with gentle agitation for 1 hr. The antibodyâ??DNA complexes were eluted from the beads by 1% SDS in TE incubated at 65°C. The beads were sedemented by centrifugation, and the supernatants were incubated overnight at 65°C to reverse the cross-linking in the chromatin-protein complex. RNA contamination was eliminated by incubating the samples with 200 mg of Rnase for 1 hour at 37°C. Finally, proteinase K (400 μg of proteinase K/mL, 1X TE) was added, and the samples were incubated for 2 h at 45°C, followed by a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation to recover the DNA. Immunoprecipitated DNA was analyzed by PCR for the enriched factor binding at target sequences. In some cases we did LM-PCR, about 20-100ng of the ChIP-DNA was blunt-ended by T4 DNA polymerase (New England Biolabs, Boston MA), then ligated with pre-annealed oligonucleotide linkers (oligo-1: GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC) using T4 DNA ligase (New England Biolabs) at 16°C overnight. The ligated DNA was further amplified by PCR with oligo-1 as a PCR primer, followed by purification using the Qiaquick PCR purification kit (Qiagen). We used Nimblegen high density promoter arrays based on human genome HG17 (Nimblegen System INC. Reykjavik Iceland).Taq Mastermix (QIAGEN) was used for PCR amplification under the following reaction conditions: 5 min at 94°C, 30 cycles of 30 sec at 94°C, 30 sec at 53°C, 30 sec at 72°C, and 10 min at 72°C. PCR products were analyzed by gel electrophoresis. DNA samples to be hybridized to microarrays were labeled by random priming with nonamer oligonucleotides attached to Cy3 or Cy5 dyes. Control samples for the chromatin immunoprecipitation experiments were total genomic DNA prepared from chromatin cross-linked and precipitated by the same procedure as the test sample but with non-specific IgG.. Test samples were labeled with Cy5 and applied to the same chip as the Cy3-labeled control sample. ChIP DNA samples were randomly primed with Cy3 and Cy5 random nonomers or septamers and the labeled fragments were hybridized to the promoter arrays. Data analysis was carried out by Tilescope [Lian Z, et al.,Genome Res. 18: 1224, 2008] and Integrated Genome Browser (IGB). Nimblegen ChIP-chip data were processed by automated Tilescope analysis [Zhang ZD, et al., Genome Biol. 8: R81, 2007]. The program normalizes Cy3 and Cy5 files of the tiling array results and identifies regions with statistically significant binding enrichment. Visualization and further analysis of the data were carried out using the IGB program (http://www.affymetrix.com/partners_programs/programs/developer/tools/download_igb.affx) and Database for Annotation, Visualization and Integrated Discovery (http://david.abcc.ncifcrf.gov/summary.jsp).

ORGANISM(S): Homo sapiens

SUBMITTER: Yasuhiro Nakayama 

PROVIDER: E-GEOD-64268 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

Similar Datasets

2025-07-14 | PXD044753 | Pride
2015-01-06 | E-GEOD-59181 | biostudies-arrayexpress
2008-12-26 | E-GEOD-12349 | biostudies-arrayexpress
2016-08-08 | E-GEOD-85341 | biostudies-arrayexpress
2011-11-29 | E-GEOD-29146 | biostudies-arrayexpress
2023-03-20 | PXD034620 | Pride
2014-06-03 | E-GEOD-56857 | biostudies-arrayexpress
2022-04-14 | PXD027801 | Pride
2012-02-27 | E-GEOD-29306 | biostudies-arrayexpress
2024-11-13 | PXD048161 | Pride