Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Identification of Sp1 targets involved in proliferation and cancer

ABSTRACT: Sp1 is a transcription factor able to regulate many genes through its DNA binding domain, containing three zinc fingers. We were interested in identifying target genes regulated by Sp1, with a special emphasis to those involved in proliferation and cancer. Our approach was to treat HeLa cells with a siRNA directed against Sp1 mRNA (siSp1) to decrease the expression of Sp1 and, in turn, the genes activated by this transcription factor. Sp1 siRNA treatment led to a great number of differentially expressed genes as determined by whole genome cDNA microarray analysis. Underexpressed genes were selected since they represent putative genes activated by Sp1. These underexpressed genes were classified in six Gene Onthology categories, namely proliferation and cancer, mRNA processing, lipidic metabolism, glucidic metabolism, transcription and translation. Putative Sp1 binding sites were found in the promoters of the selected genes using the MatchTM software. After literature mining, 11 genes were selected for further validation of their expression levels using RT-real time PCR. Underexpression was confirmed for the 11 genes plus Sp1 in HeLa cells after siSp1 treatment. Additionally, EMSA and chromatin immunoprecipitation assays were performed to test for binding between Sp1 and the promoters of these genes. We observed binding of Sp1 to the promoters of RAB20, FGF21, IHPK2, ARHGAP18, NPM3, SRSF7, CALM3, PGD and Sp1 itself. Finally, the mRNA levels of RAB20, FGF21 and IHPK2, three genes related with proliferation and cancer, were determined after overexpression of Sp1 in HeLa cells, to confirm their relationship with Sp1. The aim of our study was to evaluate, by using whole genome microarrays, the effects of a siRNA against the transcription factor of Sp1 in HeLa cells. Using this methodology genes activated by Sp1 could be downregulated. The obtective was to determine new genes regulated at the cellular level. Triplicate samples were hybridized for each experimental condition (6 samples in total). The samples provided were analyzed using the specific software GeneSpring GX.

ORGANISM(S): Homo sapiens

SUBMITTER: carlos ciudad

PROVIDER: E-GEOD-37935 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Identification of novel Sp1 targets involved in proliferation and cancer by functional genomics.

Oleaga Carlota C Welten Sabine S Belloc Audrey A Solé Anna A Rodriguez Laura L Mencia Núria N Selga Elisabet E Tapias Alicia A Noé Veronique V Ciudad Carlos J CJ

Biochemical pharmacology 20120925 12

Sp1 is a transcription factor regulating many genes through its DNA binding domain, containing three zinc fingers. We were interested in identifying target genes regulated by Sp1, particularly those involved in proliferation and cancer. Our approach was to treat HeLa cells with a siRNA directed against Sp1 mRNA to decrease the expression of Sp1 and, in turn, the genes activated by this transcription factor. Sp1-siRNA treatment led to a great number of differentially expressed genes as determined ...[more]

PMID: 23018034

Similar Datasets

Project description:A summary of the work associated to these microarrays is the following: Background: Phenolic compounds present in coffee are antioxidants in vitro that might protect against cardiovascular disease and certain types of cancer in humans. Objective: Our aim was to identify differentially expressed genes upon incubation of HT-29 human colon cancer cells with instant caffeinated coffee (ICC) or caffeic acid (CA) using microarrays. Results: In HT-29 cells incubated with ICC, 77 genes were overexpressed whereas 162 were underexpressed. Upon incubation with CA, 12 genes were overexpressed whereas 33 were underexpressed. A list of five overexpressed genes and eleven underexpressed genes were found in common between the two conditions and was use to construct a biological association network. In the generated network, STAT5B and ATF-2 appeared as highly interconnected nodes. STAT5B overexpression was confirmed at the mRNA and protein levels. For ATF-2, the changes in mRNA levels were confirmed for both ICC and CA, whereas the decrease in protein levels was only observed in CA-treated cells. The levels of cyclin D1, a target gene for both STAT5B and ATF-2 transcription factors, decreased dramatically in breast cancer cells treated with CA or ICC. Conclusions: Coffee polyphenols are able to affect gene expression in cancer cells through the modulation of STA5B and ATF-2 transcription factors. The aim of our study was to evaluate, by using whole genome microarrays, the effects of one cup of coffee, either regular caffeinated coffee or a coffee polyphenol, such as caffeic acid, on HT-29 gene expression, Three experimental approaches were conducted to assess the effects of coffee on HT29 cells. I) Incubation with non cytotoxic concentrations of ICC (7 Âµg/mL) for 24h. (Group ICC); II) Incubation with non cytotoxic concentrations of CA (1.68 Âµg/mL) for 24h. (Group CA); III) non treatment of HT-29 to refered as a control (Group CNT). Triplicate samples were hybridized for each experimental condition (9 samples in total). The samples provided were analyzed using the specific software GeneSpring GX.

Project description:The abstract of the associated publication (Selga E, NoÃ© V, Ciudad CJ. Biochemical Pharmacology 2007 Sep 8; Article in press) is the following:; While studying differentially expressed genes between sensitive and 10-5 M Methotrexate (MTX) resistant HT29 human colon cancer cells, we identified some members of the aldo-keto reductase (AKR) superfamily. The study was followed with the member AKR1C1 (EC 1.1.1.213), validating its increase in mRNA and protein levels in MTX resistant cells. The genomic content for AKR1C1 remained unchanged between sensitive and resistant cells, thereby excluding a mechanism of AKR1C1 gene amplification. Thus, we cloned the AKR1C1 human promoter and performed luciferase experiments that revealed a transcriptional regulation of the gene in the resistant cells. Computational studies showed a putative binding site for the transcription factor Sp1. The co-transfection of Sp1 or Sp3 with different constructs of AKR1C1 promoter deletions, including and excluding the proximal GC-box, demonstrated a key role for these factors in regulating AKR1C1 transcriptional activity. Gel-shift assays revealed an increase in Sp1 and Sp3 binding in resistant compared to sensitive cells, without differences in Sp1 protein levels. Dephosphorylation of the extracts coincided with a decrease in Sp1 binding, which is consistent with a process of regulation of Sp1 by phosphorylation. We also investigated the possible relationship between AKR1C1 expression and MTX action. Overexpression of AKR1C1 counteracted the S-phase accumulation of cells and apoptosis caused by MTX treatment. This suggests a role of AKR1C1 in cell proliferation. Finally, overexpression of AKR1C1 in MTX sensitive HT29 cells conferred resistance to the chemotherapeutic agent and silencing of AKR1C1 by means of iRNA technology sensitized the cells to MTX. Experiment Overall Design: Two cell lines are compared in the study, which are HT29 colon cancer cells sensitive to methotrexate and HT29 cells resistant to 10e-5M methotrexate. Six samples are provided, which correspond to triplicates of each cell line. The samples provided were subsequently normalyzed and analyzed using the specific software GeneSpring GX 7.3.1

Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle. Experiment Overall Design: Cell lines. The following human leukemia cell lines were transduced with shRNAs: K562 (Iscoves + 10% FCS) and TF-1 (RPMI + 10%FCS + rhGM-CSF. Cells were cultured at 37oC, 5% CO2 and split every 3 to 4 days. Primary AML bone marrow samples were processed as previously described [12]. All human samples were obtained with approval from the Institutional Review Board and consents were signed, according to the Helsinki protocol. Experiment Overall Design: shRNA sequence design and constructs. The CREB specific shRNA sequences were selected and validated based on accepted parameters established by Tuschl et al. [25-27]; CREB shRNA-1, CREB shRNA-2, CREB shRNA-3. Controls included empty vector, luciferase shRNA, and scrambled shRNA. shRNA sequences are: CREB shRNA-1(5âGCAAATGACAGTTCAAGCCC3â), shRNA-2 (5âGTACAGCTGGCTAACAATGG3â), shRNA-3 (5âGAGAGAGGTCCGTCTAATG3â), Luciferase shRNA (5âGCCATTCTATCCTCTAGAGGA3â), Scramble shRNA (5âGGACGAACCTGCTGAGATAT3â). Short-hairpin sequences were synthesized as oligonucleotides and annealed according to standard protocol. Annealed shRNAs were then subcloned into pSICO-R shRNA vectors from the Jacks laboratory at MIT [28]. The second generation SIN vector HIV-CSCG was used to produce human shRNA vectors [29]. Experiment Overall Design: Microarray analysis. Total RNA (10 Î¼g) was extracted from K562 cells transduced with vector alone or CREB shRNA was submitted to the UCLA DNA Microarray Facility. RNA samples were labeled and hybridized by standard protocol to Affymetrix GeneChip Human Genome U133+ Array Set HG-U133A array. Gene expression values were calculated using the MAS5 software. The expression values are quantile normalized across all arrays. We obtained the expression profiles for a control set and CREB downregulated K562 cells. These are first quantile normalized, and then a t-test is performed between the two groups to identify significantly differentially regulated genes. The analysis was performed using Matlab (Mathworks, Inc.). A normal quantile plot of T is shown in figure qqplot.tiff. Data points with t-scores < 1/(2N) display with red circles, were N is the total number of genes. We therefore see that there are a significant number of differentially expressed genes, which are either direct or indirect targets of CREB.

Dataset Information

Identification of Sp1 targets involved in proliferation and cancer

Publications

Identification of novel Sp1 targets involved in proliferation and cancer by functional genomics.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure