Single-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification

ABSTRACT: The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), termed HA-T-VP64-PU.1-14, in the 416B mouse myeloid progenitor cell line. Inducible T-VP64-PU.1-14 transgene contained within the piggyBac vector was stably integrated into 416B cells by transfection along with a constituteively expressed rtTA plasmid (pCAG-rtTA-piggyBac) and a piggyBac transposase. 416Bs carrying stably integrated transgenes were FACS sorted based on their ability to expressed the transgene and expanded before HA-T-VP64-PU.1-14 expression was induced for 48 hours by addition of dox

ORGANISM(S): Mus musculus

SUBMITTER: Rebecca Hannah 

PROVIDER: E-GEOD-61189 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress