Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

Single-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification


ABSTRACT: The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), termed HA-T-VP64-PU.1-14, in the 416B mouse myeloid progenitor cell line. Inducible T-VP64-PU.1-14 transgene contained within the piggyBac vector was stably integrated into 416B cells by transfection along with a constituteively expressed rtTA plasmid (pCAG-rtTA-piggyBac) and a piggyBac transposase. 416Bs carrying stably integrated transgenes were FACS sorted based on their ability to expressed the transgene and expanded before HA-T-VP64-PU.1-14 expression was induced for 48 hours by addition of dox before cells were fixed with 1% formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and an anti-HA antibody used to pull down the HA-T-VP64-PU.1-14 after a pre-clearing step. Chromatin was washed, de-crosslinked, amplified, size selected by gel purification and sequenced. As a control, untransfected 416B cells were similarly ChIP'd.

ORGANISM(S): Mus musculus

SUBMITTER: Rebecca Hannah 

PROVIDER: E-GEOD-61189 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

altmetric image

Publications

Single-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification.

Wilkinson Adam C AC   Kawata Viviane K S VK   Schütte Judith J   Gao Xuefei X   Antoniou Stella S   Baumann Claudia C   Woodhouse Steven S   Hannah Rebecca R   Tanaka Yosuke Y   Swiers Gemma G   Moignard Victoria V   Fisher Jasmin J   Hidetoshi Shimauchi S   Tijssen Marloes R MR   de Bruijn Marella F T R MF   Liu Pentao P   Göttgens Berthold B  

Development (Cambridge, England) 20140924 20


Transcription factors (TFs) act within wider regulatory networks to control cell identity and fate. Numerous TFs, including Scl (Tal1) and PU.1 (Spi1), are known regulators of developmental and adult haematopoiesis, but how they act within wider TF networks is still poorly understood. Transcription activator-like effectors (TALEs) are a novel class of genetic tool based on the modular DNA-binding domains of Xanthomonas TAL proteins, which enable DNA sequence-specific targeting and the manipulati  ...[more]

Similar Datasets

2014-11-05 | GSE61189 | GEO
2016-01-05 | E-GEOD-70697 | biostudies-arrayexpress
2016-03-17 | E-GEOD-69776 | biostudies-arrayexpress
2017-04-26 | GSE98177 | GEO
2006-07-08 | GSE5255 | GEO
2021-03-25 | GSE152584 | GEO
| PRJNA156515 | ENA
2012-02-10 | E-GEOD-35076 | biostudies-arrayexpress
2021-10-31 | GSE160129 | GEO
2025-07-18 | PXD046427 | Pride