Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

ABSTRACT: Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

ORGANISM(S): Homo sapiens

SUBMITTER: Stephen Floor

PROVIDER: E-GEOD-69352 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Tunable protein synthesis by transcript isoforms in human cells.

Floor Stephen N SN Doudna Jennifer A JA

eLife 20160106

Eukaryotic genes generate multiple RNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control riboso ...[more]

PMID: 26735365

Similar Datasets

Project description:Gene isoforms are mRNAs produced from the same locus, but that differ in their transcription start sites, protein coding DNA sequences, and/or untranslated regions. Consequently, different isoforms of the same gene can have altered gene function or even serve different biological functions. Conventional RNA-Seq strategies cannot accurately distinguish expression levels between distinct isoforms, and differences in gene expression studies almost always report total gene expression. However, increasing evidence indicates that differences in isoform usage may be important for the regulation of biological functions and for development of diseases such as cancer. Here, we aimed to define whether gene isoforms are subjected to differential regulation and expression by characterizing 24-hour rhythms in polyadenylation site (PAS) usage over the course of the day in the mouse liver. Conventional RNA-Seq experiments have shown that 15-30% of genes in the mouse liver are rhythmically expressed, and it is assumed that the comprising isoforms are expressed in a similar pattern. By performing 3‟-end mRNA-Seq and using stringent criteria for defining differential rhythmic expression, we show that 15% of the genes with more than one PAS exhibit differential rhythmic expression. In particular, many genes known to be rhythmic in the mouse liver harbor at least one constitutively expressed isoform, while several hundred genes characterized as arrhythmically expressed also exhibit a rhythmic isoform. Analysis of PAS usage in nuclear mRNA and single-cell data reveals that the vast majority of isoform-specific regulation does not involve post-transcriptional regulation (e.g., miRNA targeting, RNA half-life) or cell subtype-specific differences in expression. Finally, characterization of PAS usage in Bmal1-/- mice revealed that co-transcriptional regulation plays a large role in the expression of specific gene isoforms. Taken together, our results indicate that gene isoforms can be differentially regulated, and imply that gene isoforms can behave as distinct transcriptional units. Furthermore, our data suggest that conventional RNA-Seq strategies are not the most appropriate choice for detecting changes in gene isoform expression.

Dataset Information

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Publications

Tunable protein synthesis by transcript isoforms in human cells.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure