Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Long read subcellular fractionation and sequencing reveals the translational fate of full length mRNA isoforms during neuronal differentiation

ABSTRACT: Alternative splicing (AS) alters the cis-regulatory landscape of mRNA isoforms leading to transcripts with distinct localization, stability and translational efficiency. To rigorously investigate the effect of AS on ribosome association, we generated subcellular fractionation and sequencing (Frac-seq) libraries using both conventional Illumina short reads and long reads from human embryonic stem cells (ESC) and neural progenitor cells (NPC) derived from the same ESCs. We performed de novo transcriptome assembly from high confidence long reads from cytosolic, monosomal, light and heavy polyribosomal fractions and quantified their abundance using short reads from their respective subcellular fractions. Almost half of all transcripts exhibited association with particular subcellular fractions relative to the cytosol. Of the multi-isoform genes, 27% and 18% exhibited significant differential isoform sedimentation in ESC and NPC, respectively. Alternative promoter usage and internal exon skipping accounted for the majority of differences between isoforms from the same gene. Random forest classifiers implicated 3’ and 5’ untranslated regions (UTR) GC-content and coding sequence (CDS) and UTR lengths as important determinants of isoform-specific sedimentation profiles. Taken together our data demonstrate that alternative mRNA processing within the CDS and UTRs impacts the translational control of mRNA isoforms during stem cell differentiation, and highlights the utility of using long read sequencing-based method to study translational control.

ORGANISM(S): Homo sapiens

PROVIDER: GSE244655 | GEO | 2024/03/11

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

Transcriptome-wide Organization of Subcellular Microenvironments Revealed by ATLAS-Seq

Project description:Subcellular organization of RNAs and proteins is critical for cell function, but we still lack global maps and conceptual frameworks for how these molecules are localized in cells and tissues. Here we introduce ATLAS-Seq, which generates transcriptomes and proteomes from detergent-free tissue lysates fractionated across a sucrose gradient. Proteomic analysis of fractions confirmed separation of subcellular compartments. Unexpectedly, RNAs tended to co-sediment with other RNAs in similar protein complexes, cellular compartments, or biological functions. With the exception of those encoding secreted proteins, most RNAs sedimented differently than their encoded protein counterparts. To identify RNA binding proteins potentially driving these patterns, we correlated their sedimentation profiles to all RNAs, confirming known interactions and predicting new associations. Hundreds of alternative RNA isoforms exhibited distinct sedimentation patterns across the gradient, despite sharing most of their coding sequence. These observations suggest that transcriptomes can be organized into networks of co-segregating mRNAs encoding functionally related proteins, and provide insights into the establishment and maintenance of subcellular organization.

2020-04-22 | GSE140630 | GEO

Full-length transcriptome reconstruction reveals large diversity of RNA isoforms and open reading frames in rat hippocampus

Project description:We developed a hybrid-sequencing workflow, combining next-generation and third-generation sequencing, to reconstruct full-length transcriptomes. Integrating with polysome profiling and ribosome footprinting data, we predicted isoform–specific translational status and reconstructed ORFeome. Moreover, we identified isoforms with specific subcellular localization pattern in neurons.

2019-10-14 | GSE128136 | GEO

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.

2016-01-11 | GSE69352 | GEO

The dynamic landscape of fission yeast meiosis alternative-splice isoforms

Project description:Alternative splicing increases the diversity of transcriptomes and proteomes in metazoans. The extent to which alternative splicing is active and functional in unicellular organisms is less understood. Here we exploit a single-molecule long-read sequencing technique and develop a computational tool, SpliceHunter, to characterize the transcriptome in the meiosis of fission yeast. We reveal 17017 alternative splicing events in 19741 novel isoforms at different stages of meiosis, including antisense and read-through transcripts. Intron retention is the major type of alternative splicing, followed by “alternate intron in exon”. 887 novel transcription units are detected; 60 of the predicted proteins show homology in other species and form theoretical stable structures. We compare the dynamics of novel isoforms based on the number of supporting full-length reads with those of annotated isoforms and explore the translational capacity and quality of novel isoforms. The evaluation of these factors indicates that the majority of novel isoforms are unlikely to be both condition-specific and translatable but the possibility of functional novel isoforms is not excluded. Together, this study highlights the diversity and dynamics at the isoform level in the sexual development of fission yeast.

2016-11-10 | GSE79802 | GEO

Localization of functionally distinct CDC42 isoforms in neurons requires alternative 3'UTR usage

Project description:The proper subcellular localization of RNAs and local translational regulation is crucial in highly compartmentalized cells, such as neurons. RNA localization is mediated by specific cis-regulatory elements usually found in mRNA 3'UTRs. Therefore, processes that generate alternative 3'UTRs – alternative splicing and polyadenylation – have the potential to diversify mRNA localization patterns in neurons. Here, we performed mapping of alternative 3'UTRs in neurites and soma isolated from mESC-derived neurons. Our analysis identified 593 genes with differentially localized 3'UTR isoforms. In particular, we have shown that two isoforms of Cdc42 gene with distinct functions in neuronal polarity are differentially localized between neurites and soma of mESC-derived and mouse primary cortical neurons, at both mRNA and protein level. Using reporter assays and 3'UTR swapping experiments, we have identified the role of alternative 3’UTRs and mRNA transport in differential localization of alternative CDC42 protein isoforms. Moreover, we used SILAC to identify isoform-specific Cdc42 3'UTR-bound proteome with potential role in Cdc42 localization and translation. Our analysis points to usage of alternative 3'UTR isoforms as a novel mechanism to provide for differential localization of functionally diverse alternative protein isoforms.

2018-12-07 | PXD011518 | Pride

Differential regulation of alternatively polyadenylated isoforms

Project description:Alternative Cleavage and Polyadenylation (APA) plays a crucial role in the regulation of gene expression across eukaryotes. Although APA is extensively studied, its regulation within cellular compartments and its physiological impact remains largely enigmatic. Here, we employed a rigorous subcellular fractionation approach to compare APA profiles of cytoplasmic and nuclear RNA fractions from human cell lines. This comparison allowed us to extract APA isoforms that are subjected to differential regulation and provided us with a platform to interrogate the molecular regulatory pathways that shape the APA profiles in the subcellular locations. Subsequently, we depleted these cells of Dicer to compromise the miRNA biogenesis pathway to isolate the differentially regulated APA events that were regulated by miRNA.

2015-09-29 | GSE68671 | GEO

RNA 5'end sequencing in polysome profiling fractions

Project description:It has been shown that in mammalian cells alternative transcription initiation is extensively regulated during development and across cell-types, which confers dynamic transcript 5âUTR repertoire. However it is underexplored how the heterogeneity of 5âUTR isoforms would affect the downstream steps for protein expression, such as translation. To this end, we globally compared the translational profile of distinct mRNA TSS isoforms in mouse fibroblast cells, by combining deep-sequencing based mRNA 5âends profiling and polysome fractionation. We demonstrated the extensive translation regulation conferred by TSS heterogeneity. 5'end sequencing in seven polysome fractions, in two replicates, using Illumina Hiseq2000

2016-07-20 | E-GEOD-78241 | biostudies-arrayexpress

Extensive structural differences of closely related 3’ mRNA isoforms: links to Pab1 binding and mRNA stability

Project description:Alternative polyadenylation generates numerous 3' mRNA isoforms per gene; regulation of this process is critical in development and impaired in cancer. Individual isoforms from the same gene can vary greatly in biological properties such as translational efficiency, localization, and half-life. Even closely related isoforms - including those differing by a single nt - can have different biological properties, but the underlying mechanisms are unknown. Here we show that many highly similar yeast isoforms unexpectedly exhibit extensive structural variation and differential Pab1 binding, and that these physical properties serve as a good predictor of relative isoform stability. We developed DREADS, a dimethyl sulphate (DMS)-based technique, to obtain the first transcriptome-scale structural description of individual 3' mRNA isoforms in vivo. Strikingly, near-identical yeast mRNA isoforms arising from the same gene can possess dramatically different DMS modification profiles over hundreds of nt upstream of the poly(A) tail. DREADS analyses of the same mRNAs refolded in vitro or in different species indicate that structural differences in vivo are often due to trans- acting factors. CLIP-READS, a technique we developed to measure isoform-specific binding, reveals that differences in Poly(A) binding protein (Pab1) binding to 3' ends correlate with the extent of structural variation for closely-spaced isoforms. A pattern encompassing single-strandedness near the 3' terminus, double-stranded character of the poly(A) tail, and low Pab1 binding is significantly associated with mRNA stability. Sequences responsible for isoform-specific structures, differential Pab1 binding, and mRNA stability are evolutionarily conserved, and are indicative of biological function.

2018-10-11 | GSE95788 | GEO

Alternative Isoform Regulation in Human Tissue Transcriptomes

Project description:Through alternative processing of pre-mRNAs, individual mammalian genes often produce multiple mRNA and protein isoforms that may have related, distinct or even opposing functions. Here we report an in-depth analysis of 15 diverse human tissue and cell line transcriptomes based on deep sequencing of cDNA fragments, yielding a digital inventory of gene and mRNA isoform expression. Analysis of mappings of sequence reads to exon-exon junctions indicated that ~94% of human genes undergo alternative splicing (AS), ~86% with a minor isoform frequency of 15% or more. Differences in isoform-specific read densities indicated that a majority of AS and alternative cleavage and polyadenylation (APA) events exhibit variation between tissues. Variations in alternative mRNA isoform expression between 6 individuals were also detected in cerebellar cortex, with ~2- to 3-fold less isoform variation observed between individuals than between tissues. Extreme or 'switch-like' regulation of splicing between tissues was associated with increased sequence conservation and with generation of full-length open reading frames. Patterns of AS and APA were strongly correlated across tissues, suggesting coordinated regulation, and sequence conservation of known regulatory motifs in both regulated introns and 3' UTRs suggested common involvement of the same factors in regulation of tissue-specific splicing and polyadenylation. Exam mRNA expression in 15 human tissues and cell lines

2008-09-30 | E-GEOD-12946 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data