SiRNAi profiling of mouse thymus treated with GIM anti-AIRE

ABSTRACT: We used the TriFecta TM (IDT, Integrated DNA Technologies, USA) anti-Aire siRNA sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10 nM of anti-Aire siRNA using Hiperfect reagent (Qiagen) following manufacturers instructions.

After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by semi-quantitative reverse transcription PCR (RT-PCR) using the primers 5prim CATCCTGGATTTCTGGAGGA 3prim forward and 5prim GCTCTTTGAGGCCAGAGTTG 3prim reverse, which allowed amplification of a 253 bp PCR product corresponding to a segment of t

ORGANISM(S): Mus musculus

SUBMITTER: Geraldo Passos 

PROVIDER: E-MEXP-2181 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress