Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Targeted sequencing of reporter transcripts with variable GA-multivalency and intron content

ABSTRACT: These experiments use a barcoded pool of reporter transcripts, each of which encode the same mScarlet-PPIG_LCD fusion protein, but using different degrees of GA-multivalency via codon bias, and containing a different number of constitutive introns. The reporter pool was expressed either via plasmid transfection or from a dox-incudible promoter. Cells were then fractionated to obtain nuclear and cytoplasmic RNA, and the barcode sequences were amplified to determine the abundance of each different reporter transcript in each fraction. Experiments were performed in triplicate and the nuclear and cytoplasmic fractions for all replicates were multiplexed into one file, which is provided here. Different expression times were sampled to determine how nuclear/cytoplasmic localisation changed in response to changes in PPIG-LCD protein accumulation. In one instance, the effect of the CLK inhibitor CLK-IN-T3 was tested. Multiple experimental conditions are provided: Experiment 1: transfection for 16 hours. Experiment 2: transfection for either 8 or 24 hours. Experiment 3: dox-induction for either 4, 8, or 12 hours. Note: expression kinetics are faster with dox induction than transfection. Experiment 4: dox-induction for 6 hours, either with 1 uM CLK-IN-T3 treatment, or with equivalent volume DMSO. Treatment began 2 hours before dox-induction. Each correct read in each sample should contain the following sequences in the following order: UMIs (N) and experimental barcodes (B): NNNNNBBBBNNNNN A fixed sequence: GGCCTGCGGATCC A unique plasmid barcode, which identifies the reporter transcript: NNNNNNNNNNNNNNNNNNNN A fixed sequence: GTTGTCGATCGAGACGTAAT Illumina adapter sequences. The experimental barcode arrangement for each sample is provided as a supplement to this accession.

INSTRUMENT(S): Maxwell RSC Instrument, Illumina NovaSeq 6000

ORGANISM(S): Homo sapiens

SUBMITTER: Jernej Ule

PROVIDER: E-MTAB-13329 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:Although genetic studies have identified many hundreds of loci associated with human traits and diseases, pinpointing the causal alleles remains difficult, particularly for non-coding variants. To address this challenge, we have enhanced the sensitivity and reproducibility of the massively parallel reporter assay (MPRA), adapting it to identify variants that directly modulate gene expression. We then applied it to over 29,000 single nucleotide and insertion/deletion polymorphisms from 3,965 cis-expression quantitative trait loci (eQTL). We demonstrate strong correlation between our MPRA approach and existing measures of regulatory function, and determine an approximate sensitivity of ~20% with a positive predictive value of 60-65% to detect an eQTL causal allele. We identify 842 variants showing differential expression between alleles, including 53 well-annotated variants associated with diseases and traits. Thus, we have created a resource of concrete leads for understanding the genetic basis of specific phenotypes and illustrate the promise of this kind of approach for comprehensively interrogating how non-coding polymorphism shapes human biology. The study consists of two separate MPRA experiments, a 78,958 oligo (79k study) and a 7,500 oligo library (7.5k). For each library we processed independent transfections into two lymphoblastoid cell lines; in total we completed 5 replicates of NA12878 and 3 replicates of NA19239. For the 79k library we also performed 5 replicate transfections into the hepatocarcinoma cell line HepG2. Raw data is provided as Illumina reads of the 20 bp barcode from the RNA extracted 24 hours post transfection as well as from the plasmid library used for transfection. We also provide oligo/barcode combinations from the âgfp vector in the form of a tab delimited file containing the raw sequence reads of the barcode (column 1) and genomic sequence (column 2). Processed count files are unnormalized counts for each oligo acquired by summing all barcode matches together for each replicate.

Project description:Arginine-rich mixed charge domains (R-MCDs) contribute to and alter the properties of nuclear speckles. We are interested in how this affects the retention of poly-adenylated mRNAs in the nucleus. This experiment tests how the expression of the R-MCD of PPIG influences the nuclear-cytoplasmic distribution of mRNAs over time. Specifically, a HeLa cell line in which PPIG expression is driven by a doxycycline-inducible promoter was used, and doxycycline was added for 0, 4, 8 or 12 hours. This time course was performed in triplicates. Nuclear and cytoplasmic fractions were collected from the cells and RNA was extracted. 3' end sequencing libraries were produced by fragmenting the RNA and introducing Illumina adapters via a oligo-dT-primed reverse transcription and template switching oligo approach. The data indicate that mRNAs containing long, multivalent GA-rich regions in their coding sequences are more retained in the nucleus over time following expression of the R-MCD. The files provided in this accession have not been trimmed to remove adapters, 3' poly-A sequences, UMIs or G-stretches from TSOs. The data was analysed using nf-core/rna-seq using the following command: nextflow run nf-core/rnaseq \\ --input samplesheet.csv \\ --fasta '/camp/lab/ulej/home/users/farawar/genomes/hs/fasta/GRCh38.primary_assembly.genome.fa' \\ --gtf '/camp/lab/ulej/home/users/farawar/genomes/hs/annotation/gencode.v29.annotation.gtf' \\ --salmon_index '/camp/lab/ulej/home/users/farawar/genomes/hs/salmon_index/salmon_index' \\ --gencode \\ --pseudo_aligner salmon \\ --with_umi \\ --umitools_bc_pattern NNNNN \\ --clip_r1 5 \\ -resume \\ -profile crick \\ --outdir nf-core-results \\ -c extraconfig.config With the extra config file containing: withName: '.*:QUANTIFY_STAR_SALMON:SALMON_QUANT' { ext.args = '--noLengthCorrection' } Therefore removing the first 5 nucleotides as UMI sequences and the following 5 nucleotides as they contain G-stretches from the template-switching oligo.

Dataset Information

Targeted sequencing of reporter transcripts with variable GA-multivalency and intron content

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets