LwaCas13a haphazardly targets the human transcriptome
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina NovaSeq 6000
ORGANISM(S): Homo sapiens
SUBMITTER:
PROVIDER: E-MTAB-14334 | biostudies-arrayexpress |
SECONDARY ACCESSION(S): ERP163006
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:Post-transcriptional chemical modification of RNA bases is a widespread and physiologically relevant regulator of RNA maturation, stability, and function. While modifications are best characterized in short, noncoding RNAs such as transfer RNAs (tRNAs), growing evidence indicates that messenger RNAs (mRNAs) and long noncoding RNAs (lncRNAs) are likewise modified. Here, we apply our High-throughput Annotation of Modified Ribonucleotides (HAMR) pipeline to identify and classify modifications that affect Watson-Crick base-pairing at three different levels of the human and Arabidopsis thaliana transcriptomes (polyadenylated, small, and degrading RNAs). We find modifications primarily within actively degrading mRNAs and lncRNAs, suggesting they can act as a potent signal for RNA turnover. Additionally, modifications within stable mRNAs mark alternatively spliced introns, suggesting they regulate splicing. Furthermore, these modifications target mRNAs with coherent functions, including stress responses. Thus, our comprehensive analysis of RNA modification across multiple RNA classes yields new functional insights into these covalent RNA additions. polyA-selected RNA-seq, smRNA-seq, and polyA-selected global mapping of uncapped transcripts (GMUCT) in Arabidopsis thaliana; smRNA-seq in HEK293T and HeLa human cell lines.
2015-10-31 | E-GEOD-66224 | biostudies-arrayexpress
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress
Project description:The CRISPR-Cas system represents an RNA-based adaptive immune response system in prokaryotes. CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) consist of arrays of short repeat sequences interspaced by non-repetitive short spacers, some of which show sequence similarity to foreign phage genetic elements. Their cistronic transcripts are processed to produce the mature CRISPR RNAs (crRNAs), the elements that confer immunity by base-pairing with exogenous nucleic acids. We characterized the expression and processing patterns of Thermus thermophilus HB8 CRISPRs using differential deep-sequencing, which differentiates between 5’ monophosphate and 5’ non-monophosphate-containing RNAs, and/or between 3’ hydroxyl and 3’ non-hydroxyl-containing RNAs. The genome of T. thermophilus HB8 encodes 11 CRISPRs, classified into three distinct repeat sequence types, all of which were constitutively expressed without deliberately infecting the bacteria with phage. Analysis of the differential deep sequencing data suggested that crRNAs are generated by endonucleolytic cleavage, leaving fragments with 5’ hydroxyl and 3’ phosphate or 2’,3’-cyclic phosphate termini. The 5’ ends of all crRNAs are generated by site-specific cleavage eight nucleotides upstream of the spacer start position, however, the 3’ ends, are generated by two alternative, repeat-sequence-type-dependent mechanisms. These observations are consistent with the operation of multiple crRNA processing systems within a bacterial strain.
2012-02-25 | GSE34328 | GEO
Project description:To analyze the roles of GSK-3β in podocytes, GSK-3β knockdown lentivirus by Clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein (Cas)9 was applied to establish stable cell lines. Phosphoproteome and proteome evaluation was conducted using TMT labeled LC-MS/MS technologies.
2021-09-10 | PXD024543 | Pride
Project description:Genome-wide analyses have identified thousands of long non-coding RNAs (lncRNAs). Malat1 (Metastasis Associated Lung Adenocarcinoma Transcript 1) is among the most abundant lncRNAs whose expression is altered in numerous cancers. Here we report that genomic loss, as well as systemic knockdown of Malat1 using antisense oligonucleotides, in the MMTV-PyMT mouse mammary carcinoma model results in slower tumor growth accompanied by differentiation into highly cystic tumors and a significant reduction in lung metastasis. Further, Malat1 loss results in a reduction of branching morphogenesis in MMTV-PyMT and Her2/neu amplified tumor organoids consistent with the in vivo reduction in lung metastasis. At the molecular level, Malat1 knockdown results in alterations in gene expression and changes in splicing patterns of genes involved in differentiation and pro-tumorigenic signaling pathways. Together, these data indicate that the lncRNA Malat1 regulates critical processes in mammary cancer pathogenesis and represents a promising therapeutic target for inhibiting breast cancer metastasis. Transcriptome profiles of tumors and organoids after Malat1 knockdown using antisense olgonucleotides (ASOs).
2016-01-12 | E-GEOD-67647 | biostudies-arrayexpress
Project description:We combined clustered regularly interspaced short palindromic repeats/Cas9-mediated gene knockout technology with affinity purification using antibodies against endogenous proteins followed by mass spectrometry analysis, to sensitively and precisely detect protein-protein interactions in unaltered in vivo settings. Using this system, we analyzed endogenous neurofibromin-associated protein complexes.
2017-03-15 | PXD005107 | Pride
Project description:Small RNAs play important roles during plant development by regulating transcript levels of target mRNAs, maintaining genome integrity, and reinforcing DNA methylation. Dicer-like 5 (Dcl5) is proposed to be responsible for precise slicing to generate diverse 24-nt phased, secondary small interfering RNAs (phasiRNAs), which are exceptionally abundant in meiotic anthers of maize, rice, and other grasses 1. Importance and functions of these phasiRNAs remain unclear. Here we used the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Cas9 system to mutate Dcl5. We report that dcl5 mutants have few or no 24-nt phasiRNAs, develop short anthers and defective tapetal cells, and exhibit temperature-sensitive male fertility. We propose that DCL5 and 24-nt phasiRNAs are critical for fertility under growth regimes for optimal yield.
2018-12-17 | GSE122449 | GEO
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM).
2014-08-29 | GSE57650 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress