Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

RNA-seq in WTC11 i3 lower-motor neurons with and without TDP-43 knockdown

ABSTRACT: Nuclear depletion and cytoplasmic aggregation of the RNA-binding protein TDP-43 is the hallmark of ALS, occurring in over 97% of cases. A key consequence of TDP-43 nuclear loss is the de-repression of cryptic exons. Motor neurons are the vulnerable cell-type in ALS and cryptic exons show variability in expression by cell-type. A human induced pluripotent stem cell (iPSC) line (WTC11), stably expressing a doxycycline-inducible hNIL construct and CRISPR/Cas9 was used in this study. Differentiation of human iPSCs was performed as previously reported. Briefly, iPSC induction was achieved using induction medium containing DMEM/F12, GlutaMAX supplement medium (Thermo Fisher), MEM non-essential amino acids (Thermo Fisher), N2 supplement (Thermo Fisher), 0.2 mM compound E, 2 μg/ml doxycycline, Pen/Strep and 10 μM Y-27632. After induction for 48 h, cells were dissociated from plates by Accutase and reseeded on poly-D-lysine (PDL)/laminin-coated tissue culture dishes or microfluidic devices in induction medium supplemented with 1 μg/ml laminin. After 24 h, induction medium was replaced by motor neuron medium containing Neurobasal (Thermo Fisher), B27 Plus supplement (Thermo Fisher), N2 supplement, Culture One supplement (Thermo Fisher), 1 μg/ml laminin, 2 μg/ml doxycycline, and Pen/Strep. Medium change was performed every 1-3 days. To achieve knockdown, sgRNAs targeting TARDBP (GGGAAGTCAGCCGTGAGACC) were delivered to iPS cells by lentiviral transduction.

INSTRUMENT(S): NA, NextSeq 2000

ORGANISM(S): Homo sapiens

SUBMITTER: Anna-Leigh Brown

PROVIDER: E-MTAB-15433 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:Specific neuronal types derived from embryonic stem cells (ESCs) can facilitate mechanistic studies and potentially aid in regenerative medicine. Existing induction methods, however, mostly rely on the effects of growth factors, which generally tend to result in mixed populations of neurons. Here we report that over-expression of specific transcription factors (TFs) in ESCs can rather guide the differentiation of ESCs towards specific neuron types. Analysis of published data on gene expression changes early (two days) after induction of each of 185 induced TFs implicated candidate TFs for further ESC differentiation studies. After induction for 6 days four of them (Ascl1, Smad7, Nr2f1, and Ascl2) generated a high proportion (>35%) of cells with neural progenitor marker PSA-NCAM and clear neural morphology on day 14. The capacity of these TFs to induce neural differentiation is inferred to be most likely linked to early activation of the Notch signaling pathway. Among the neuron-like cells, GABA-positive cells were most abundant (32-97% for 4 top TFs), whereas Isl1-positive cells and TH-positive cells were less abundant (<12% and <5%, respectively). Enrichment of cells obtained with the induction of Ascl1, Smad7, and Nr2f1 using beads with anti-PSA-NCAM antibody resulted in essentially pure population of neuron-like cells with expression profiles similar to neural tissues and highly expressed markers of GABAergic neurons. A time-course experiment with induction of Ascl1 showed early upregulation of most neural-specific and GABAergic-specific mRNA and miRNAs. We identified mRNA and miRNAs, whose expression depended on the induction of Ascl1, and showed that they were enriched in Ascl1 target genes. In summary, this study indicates that induction of transcription factors is a promising approach to generate candidate specific neural cell types from ESCs. Transcription factor Ascl1 was induced in mouse ESCs to facilitate neural differentiation. Expression of transgenic Ascl1 was repressed by doxycycline (Dox); thus, it were induced in Dox- conditions, whereas Dox+ conditions represent control cells with no expression of Ascl1 transgene. For neural differentiation, cells were cultured 3 days in alpha-MEM medium and then - in NeuroCult neural differentiation medium for 2-11 days (total up to 14 days). RNA was extracted with mirVana kit (Thermo Fisher Scientific).

Dataset Information

RNA-seq in WTC11 i3 lower-motor neurons with and without TDP-43 knockdown

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets