Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

RNA-seq in WTC11 i3 lower-motor neurons with and without TDP-43 knockdown


ABSTRACT: Nuclear depletion and cytoplasmic aggregation of the RNA-binding protein TDP-43 is the hallmark of ALS, occurring in over 97% of cases. A key consequence of TDP-43 nuclear loss is the de-repression of cryptic exons. Motor neurons are the vulnerable cell-type in ALS and cryptic exons show variability in expression by cell-type. A human induced pluripotent stem cell (iPSC) line (WTC11), stably expressing a doxycycline-inducible hNIL construct and CRISPR/Cas9 was used in this study. Differentiation of human iPSCs was performed as previously reported. Briefly, iPSC induction was achieved using induction medium containing DMEM/F12, GlutaMAX supplement medium (Thermo Fisher), MEM non-essential amino acids (Thermo Fisher), N2 supplement (Thermo Fisher), 0.2 mM compound E, 2 μg/ml doxycycline, Pen/Strep and 10 μM Y-27632. After induction for 48 h, cells were dissociated from plates by Accutase and reseeded on poly-D-lysine (PDL)/laminin-coated tissue culture dishes or microfluidic devices in induction medium supplemented with 1 μg/ml laminin. After 24 h, induction medium was replaced by motor neuron medium containing Neurobasal (Thermo Fisher), B27 Plus supplement (Thermo Fisher), N2 supplement, Culture One supplement (Thermo Fisher), 1 μg/ml laminin, 2 μg/ml doxycycline, and Pen/Strep. Medium change was performed every 1-3 days. To achieve knockdown, sgRNAs targeting TARDBP (GGGAAGTCAGCCGTGAGACC) were delivered to iPS cells by lentiviral transduction.

INSTRUMENT(S): NA, NextSeq 2000

ORGANISM(S): Homo sapiens

SUBMITTER: Anna-Leigh Brown 

PROVIDER: E-MTAB-15433 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

Similar Datasets

2026-05-27 | GSE308274 | GEO
2024-05-27 | GSE175663 | GEO
2022-12-13 | GSE220275 | GEO
2019-01-01 | E-MTAB-7820 | biostudies-arrayexpress
2025-01-15 | GSE228249 | GEO
2016-07-21 | E-GEOD-78950 | biostudies-arrayexpress
2021-06-07 | GSE173094 | GEO
2020-05-06 | PXD018714 | Pride
2019-08-23 | GSE119042 | GEO
2019-08-23 | GSE119041 | GEO