Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptomic profiling of neutrophils from patients with chronic recurrent multifocal osteomyelitis (CRMO) and healthy age-matched controls

ABSTRACT: The goal is to identify differntially expressed genes in multifocal osteomyelitis (CRMO) neutrophils to understand the mechanism of neutrophil dysregulation contributing to CRMO development.

INSTRUMENT(S): NextSeq 2000

ORGANISM(S): Homo sapiens

SUBMITTER: Jan Kubovčiak

PROVIDER: E-MTAB-16634 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Tenascin-C shapes TRAIL control over tumor immunity

Project description:TRAIL cytotoxicity is exploited as anti-cancer therapy since many years, however incomplete knowledge is generating many obstacles. Here, we address whether the highly abundant extracellular matrix molecule tenascin-C (TNC) orchestrating an immune suppressive tumor microenvironment and binding TRAIL impacts TRAIL cytotoxicity. We used an immune competent autologous NT193 breast cancer model with a knockdown (KD) of Tnfsf10 (encoding TRAIL) and observed accelerated tumor growth marked by less apoptosis, more proliferation and less myeloid cell infiltration as seen by flow cytometry. Grafting the same Tnfsf10 KD cells into a TNC knockout host showed repressed tumor growth suggesting that TNC is involved in regulating TRAIL functions.

2024-05-30 | E-MTAB-14089 | biostudies-arrayexpress

RNA sequencing of Alexander, HepG2, and Huh7 cells cultured on ESS dishes with different stiffnesses (1.5, 15, 28 kPa and reference GPa) for 48 h

Project description:To better understand how mechanical signals influence liver cancer cell behavior, we employed transcriptomic analysis using bulk RNA sequencing. Alexander, HepG2, and Huh7 cells were cultured for 48 hours on ESS dishes with varying stiffness to assess their global transcriptional responses to different extracellular matrix (ECM) conditions. Differential expression analysis revealed extensive transcriptional changes in all three cell lines, with Huh7 cells exhibiting the strongest response - demonstrated by the highest number of significantly altered genes and pathways.

2026-05-11 | E-MTAB-15569 | biostudies-arrayexpress

Gene expression profiling of TROP2+ cells from human CRC (colorectal carcinoma) specimens

Project description:The Trophoblast cell surface antigen 2 (TROP2) is a transmembrane glycoprotein encoded by the Tumor associated calcium signal transducer 2 (TACSTD2) gene. TROP2 is upregulated in many human malignancies including colorectal cancer, and its overexpression correlates with tumor progression, invasiveness, and poor survival. Functional studies revealed that TROP2 may have a role as both an oncogene and a tumor suppressor. To identify TROP2 function in human cancer cells, we performed gene expression profiling of TROP2+ and TROP2- cells isolated from human colon tumors. Due to the sensitive nature of the data, raw data files have not been uploaded.

2022-12-31 | E-MTAB-11466 | biostudies-arrayexpress

RNA-seq of engineered K562 cell line by CRISPR/Cas9 generation of t(7;12)(q36;p13) chromosomal translocation

Project description:We recreated the t(7;12) translocation in K562 cells by CRISPR/Cas9 to understand its effects on haematopoietic cells, which is of relevance to understand how this cytogenetic abnormalities causes and promotes acute leukaemia in infants. Wild-type K562 were edited by electroporation of ribonucleoprotein complexes consisting of Cas9 enzyme and two guide RNAs targeting patient-specific breakpoint loci. K562 electroporated with Cas9 enzyme only were used as control. Edited K562 harbouring the t(7;12) were single-cell cloned to obtain homogeneous populations (hereby referred to as K562-t(7;12)). We performed RNA sequencing analysis of K562-t(7;12) compared to K562 control to uncover transcriptional changes associated with the translocation.

2022-09-06 | E-MTAB-11851 | biostudies-arrayexpress

RNA-seq in WTC11 i3 lower-motor neurons with and without TDP-43 knockdown

Project description:Nuclear depletion and cytoplasmic aggregation of the RNA-binding protein TDP-43 is the hallmark of ALS, occurring in over 97% of cases. A key consequence of TDP-43 nuclear loss is the de-repression of cryptic exons. Motor neurons are the vulnerable cell-type in ALS and cryptic exons show variability in expression by cell-type. A human induced pluripotent stem cell (iPSC) line (WTC11), stably expressing a doxycycline-inducible hNIL construct and CRISPR/Cas9 was used in this study. Differentiation of human iPSCs was performed as previously reported. Briefly, iPSC induction was achieved using induction medium containing DMEM/F12, GlutaMAX supplement medium (Thermo Fisher), MEM non-essential amino acids (Thermo Fisher), N2 supplement (Thermo Fisher), 0.2 mM compound E, 2 μg/ml doxycycline, Pen/Strep and 10 μM Y-27632. After induction for 48 h, cells were dissociated from plates by Accutase and reseeded on poly-D-lysine (PDL)/laminin-coated tissue culture dishes or microfluidic devices in induction medium supplemented with 1 μg/ml laminin. After 24 h, induction medium was replaced by motor neuron medium containing Neurobasal (Thermo Fisher), B27 Plus supplement (Thermo Fisher), N2 supplement, Culture One supplement (Thermo Fisher), 1 μg/ml laminin, 2 μg/ml doxycycline, and Pen/Strep. Medium change was performed every 1-3 days. To achieve knockdown, sgRNAs targeting TARDBP (GGGAAGTCAGCCGTGAGACC) were delivered to iPS cells by lentiviral transduction.

2026-07-04 | E-MTAB-15433 | biostudies-arrayexpress

RNA-Seq of human hematopoietic stem and progenitor cells to study membrane repair following electroporation (EP) or filtroporation (FP) disruption based strategies for intracellular delivery

Project description:This experiment investigates how different intracellular delivery methods, specifically filtroporation (FP) and electroporation (EP) affect gene editing efficiency and cellular responses in human hematopoietic stem and progenitor cells. By comparing these methods, results show how mechanical versus electrical membrane disruption influences gene expression, cell fate, and membrane repair mechanisms. This study also explores the molecular processes involved in rapid membrane repair, highlighting the roles of calcium signaling and key repair proteins such as GRAF1, SNAP23, and CHMP4B.

2025-10-30 | E-MTAB-15741 | biostudies-arrayexpress

RNA-seq of human liver biopsies from patients with NAFLD, patient with cirrhosis, and healthy controls under both fasting and postprandial conditions.

Project description:The data provides a unique opportunity for investigating the differences in the hepatic transcriptome in health and liver disease through studying gene expression in a cohort of patients with NAFLD, cirrhosis, and healthy controls. The randomization of patients and healthy controls between the fasting and fed state further enables exploration of differences in the liver transcriptome.

2023-08-27 | E-MTAB-12807 | biostudies-arrayexpress

RNA-Seq of human lung cancer cell line A549 co-cultivated with cancer-associated fibroblasts from brain metastases

Project description:In this study, we investigate the differences in the A549 human lung adenocarcinoma cell line when cultured independently versus in co-culture with cancer-associated fibroblasts (CAFs). After cultivation, tumor cells were isolated by cell sorting to ensure high purity (sorting purity >98%, and often reaching 100%). The CAFs used in this study were derived from brain metastases from two distinct sources.

2026-07-28 | E-MTAB-15451 | biostudies-arrayexpress

RNA-seq of human HEK293-T cells expressing U2AF2 paralogues of Fritillaria borealis

Project description:The goal of the experiment is to reveal splicing changes associated with the expression of U2AF2 splicing factors genes. U2AF2 constructs were transfected into HEK293-T cells and RNA was extracted for polyA transcriptome sequencing 3 days post transfection.

2026-06-11 | E-MTAB-15864 | biostudies-arrayexpress

Bulk RNA sequencing of coding RNA from splenic dendritic cells isolated from interleukin-2 complex-treated and untreated mice

Project description:We discovered that interleukin-2 expands mouse dendritic cells in vivo. This RNA-seq experiment intended to identify the transcriptional changes in mouse conventional dendritic cells after interleukin-2 complex treatment and to possibly identify activated signaling pathways.

2020-09-16 | E-MTAB-8991 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data