Unknown

Dataset Information

0

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.


ABSTRACT: The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

SUBMITTER: Horiuchi T 

PROVIDER: S-EPMC135454 | biostudies-literature | 2002 Dec

REPOSITORIES: biostudies-literature

altmetric image

Publications

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Horiuchi Takayuki T   Akiyama Takuya T   Inouye Sumiko S   Komano Teruya T  

Journal of bacteriology 20021201 24


The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and  ...[more]

Similar Datasets

| S-EPMC149949 | biostudies-literature
| S-EPMC134796 | biostudies-literature
| S-EPMC8561891 | biostudies-literature
2008-02-01 | GSE9477 | GEO
| S-EPMC111401 | biostudies-literature
| S-EPMC3078403 | biostudies-literature
| S-EPMC107706 | biostudies-literature
| S-EPMC6791715 | biostudies-literature
| S-EPMC177228 | biostudies-other
| S-EPMC7810364 | biostudies-literature