Identifying protein-coding genes in genomic sequences.
Ontology highlight
ABSTRACT:
SUBMITTER: Harrow J
PROVIDER: S-EPMC2687780 | biostudies-literature | 2009
REPOSITORIES: biostudies-literature
Publications
Identifying protein-coding genes in genomic sequences.
Harrow Jennifer J Nagy Alinda A Reymond Alexandre A Alioto Tyler T Patthy Laszlo L Antonarakis Stylianos E SE Guigó Roderic R
Genome biology 20090130 1
The vast majority of the biology of a newly sequenced genome is inferred from the set of encoded proteins. Predicting this set is therefore invariably the first step after the completion of the genome DNA sequence. Here we review the main computational pipelines used to generate the human reference protein-coding gene sets. ...[more]
Similar Datasets
Project description:Non-functioning pituitary adenoma (NFPA) is a very common type of intracranial tumor. Monitoring and predicting the postoperative recurrence of NFPAs is difficult, as these adenomas do not present with serum hormone hypersecretion. Long non-coding RNAs (lncRNAs) and protein-coding genes (PCGs) play critical roles in the development and progression of numerous tumors. However, the complex network of RNA interactions related to the mechanisms underlying the postoperative recurrence of NFPA is still unclear. In the present study, 73 patients with NFPA were investigated using high-throughput sequencing and follow-up investigations. In total, 6 of these patients with recurrence within 1 year after surgery were selected as the fast recurrence group, and 6 patients with recurrence 5 years after surgery were selected as the slow recurrence group. By performing differential expression analysis of the fast recurrence and slow recurrence groups, a set of differentially expressed PCGs and lncRNAs were obtained (t-test, P<0.05). Next, protein-protein interaction coregulatory networks and lncRNA-mRNA coexpression networks were identified. In addition, the hub lncRNA-mRNA modules related to NFPA recurrence were further screened and transcriptome expression markers for NFPA regression were identified (log-rank test, P<0.05). Finally, the ability of the hub and module genes to predict recurrence and progression-free survival in patients with NFPA was evaluated. To confirm the credibility of the bioinformatic analyses, nucleolar protein 6 and LL21NC02-21A1.1 were randomly selected from among the genes with prognostic significance for validation by reverse transcription-quantitative PCR in another set of NFPA samples (n=9). These results may be helpful for evaluating the slow and rapid recurrence of NFPA after surgery and exploring the mechanisms underlying NFPA recurrence. Future effective biomarkers and therapeutic targets may also be revealed.
| S-EPMC7882882 | biostudies-literature
Project description:BACKGROUND:Rapidly accumulating genome sequence data from multiple species offer powerful opportunities for the detection of DNA sequence evolution. Phylogenetic tree construction and codon-based tests for natural selection are the prevailing tools used to detect functionally important evolutionary change in protein coding sequences. These analyses often require multiple DNA sequence alignments that maintain the correct reading frame for each collection of putative orthologous sequences. Since this feature is not available in most alignment tools, codon reading frames often must be checked manually before evolutionary analyses can commence. RESULTS:Here we report an online codon-preserved alignment tool (OCPAT) that generates multiple sequence alignments automatically from the coding sequences of any list of human gene IDs and their putative orthologs from genomes of other vertebrate tetrapods. OCPAT is programmed to extract putative orthologous genes from genomes and to align the orthologs with the reading frame maintained in all species. OCPAT also optimizes the alignment by trimming the most variable alignment regions at the 5' and 3' ends of each gene. The resulting output of alignments is returned in several formats, which facilitates further molecular evolutionary analyses by appropriate available software. Alignments are generally robust and reliable, retaining the correct reading frame. The tool can serve as the first step for comparative genomic analyses of protein-coding gene sequences including phylogenetic tree reconstruction and detection of natural selection. We aligned 20,658 human RefSeq mRNAs using OCPAT. Most alignments are missing sequence(s) from at least one species; however, functional annotation clustering of the ~1700 transcripts that were alignable to all species shows that genes involved in multi-subunit protein complexes are highly conserved. CONCLUSION:The OCPAT program facilitates large-scale evolutionary and phylogenetic analyses of entire biological processes, pathways, and diseases.
| S-EPMC2093931 | biostudies-literature
Project description:The falsely annotated protein-coding genes have been deemed one of the major causes accounting for the annotating errors in public databases. Although many filtering approaches have been designed for the over-annotated protein-coding genes, some are questionable due to the resultant increase in false negative. Furthermore, there is no webserver or software specifically devised for the problem of over-annotation. In this study, we propose an integrative algorithm for detecting the over-annotated protein-coding genes in microorganisms. Overall, an average accuracy of 99.94% is achieved over 61 microbial genomes. The extremely high accuracy indicates that the presented algorithm is efficient to differentiate the protein-coding genes from the non-coding open reading frames. Abundant analyses show that the predicting results are reliable and the integrative algorithm is robust and convenient. Our analysis also indicates that the over-annotated protein-coding genes can cause the false positive of horizontal gene transfers detection. The webserver of the proposed algorithm can be freely accessible from www.cbi.seu.edu.cn/RPGM.
| S-EPMC3223076 | biostudies-literature
Project description:Genome-wide association studies (GWAS) have identified many single nucleotide polymorphisms (SNPs) that play important roles in the genetic heritability of traits and diseases. With most of these SNPs located on the non-coding part of the genome, it is currently assumed that these SNPs influence the expression of nearby genes on the genome. However, identifying which genes are targeted by these disease-associated SNPs remains challenging. In the past, protein knowledge graphs have often been used to identify genes that are associated with disease, also referred to as "disease genes". Here, we explore whether protein knowledge graphs can be used to identify genes that are targeted by disease-associated non-coding SNPs by testing and comparing the performance of six existing methods for a protein knowledge graph, four of which were developed for disease gene identification. We compare our performance against two baselines: (1) an existing state-of-the-art method that is based on guilt-by-association, and (2) the leading assumption that SNPs target the nearest gene on the genome. We test these methods with four reference sets, three of which were obtained by different means. Furthermore, we combine methods to investigate whether their combination improves performance. We find that protein knowledge graphs that include predicate information perform comparable to the current state of the art, achieving an area under the receiver operating characteristic curve (AUC) of 79.6% on average across all four reference sets. Protein knowledge graphs that lack predicate information perform comparable to our other baseline (genetic distance) which achieved an AUC of 75.7% across all four reference sets. Combining multiple methods improved performance to 84.9% AUC. We conclude that methods for a protein knowledge graph can be used to identify which genes are targeted by disease-associated non-coding SNPs.
| S-EPMC9278741 | biostudies-literature
Project description:Overlapping fragments of genomic RNA spanning 6963 nucleotides from 5' end of spike (S) protein gene to 3' end of nucleocapsid (N) protein gene of turkey coronavirus (TCoV) were amplified by reverse-transcription-polymerase chain reaction (RT-PCR). The primers were derived from the corresponding sequences of infectious bronchitis virus (IBV). The PCR products were cloned and sequenced and their nucleic acid structure and similarity to published sequences of other coronaviruses were analyzed. Sequencing and subsequent analysis revealed 9 open reading frames (ORFs) representing the entire S protein gene, tricistronic gene 3, membrane (M) protein gene, bicistronic gene 5, and N protein gene in the order of 5'-3'. The overall nucleic acid structures of these encoding regions of TCoV were very similar to the homologous regions of IBV. The consensus transcription-regulating sequence (TRS) of IBV, CT(T/G)AACAA, was highly conserved in TCoV genome at the levels of nucleotide sequence and location in regarding to the initiation codon of individual genes. Pair-wise comparison of gene 3, M gene, gene 5, or N gene sequences with their counterparts of IBV revealed high levels (82.1-92.0%) of similarity. Phylogenetic analysis based on the deduced amino acid sequences of S, M, or N protein demonstrated that TCoV was clustered within the same genomic lineage as the IBV strains while all the other mammalian coronaviruses were grouped into separate clusters corresponding to antigenic groups I or II. There were substantial differences of S protein sequence between TCoV and IBV with only 33.8-33.9% of similarity.
| S-EPMC7114097 | biostudies-literature
Project description:We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a-j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a-d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a-c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a-c families should be in one family.
| S-EPMC3727082 | biostudies-literature
Project description:Among all of the many examples of mobile elements or "parasitic sequences" that affect the function of the human genome, this paper describes several examples of functioning genes whose sequences have been almost completely derived from mobile elements. There are many examples where the synthetic coding sequences of observed mRNA sequences are made up of mobile element sequences, to an extent of 80% or more of the length of the coding sequences. In the examples described here, the genes have named functions, and some of these functions have been studied. It appears that each of the functioning genes was originally formed from mobile elements and that in some process of molecular evolution a coding sequence was derived that could be translated into a protein that is of some importance to human biology. In one case (AD7C), the coding sequence is 99% made up of a cluster of Alu sequences. In another example, the gene BNIP3 coding sequence is 97% made up of sequences from an apparent human endogenous retrovirus. The Syncytin gene coding sequence appears to be made from an endogenous retrovirus envelope gene.
| S-EPMC534736 | biostudies-literature
Project description:Pathways leading to formation of non-coding RNA and protein genes are varied and complex. We report finding a conserved repeat sequence present in human and chimpanzee genomes that appears to have originated from a common primate ancestor. This sequence is repeatedly copied in human chromosome 22 (chr22) low copy repeats (LCR22) or segmental duplications and forms twenty-one different genes, which include the human long intergenic non-coding RNA (lincRNA) family FAM230, a newly discovered lincRNA gene family termed conserved long intergenic non-coding RNAs (clincRNA), pseudogene families, as well as the gamma-glutamyltransferase (GGT) protein gene family and the RNA pseudogenes that originate from GGT sequences. Of particular interest are the GGT5 and USP18 protein genes that appear to have formed from an homologous repeat sequence that also forms the clincRNA gene family. The data point to ancestral DNA sequences, conserved through evolution and duplicated in humans by chromosomal repeat sequences that may serve as functional genomic elements in the development of diverse genes.
| S-EPMC7098633 | biostudies-literature
Project description:Recently non-coding RNA (ncRNA) genes have been found to serve many important functions in the cell such as regulation of gene expression at the transcriptional level. Potentially there are more ncRNA molecules yet to be found and their possible functions are to be revealed. The discovery of ncRNAs is a difficult task because they lack sequence indicators such as the start and stop codons displayed by protein-coding RNAs. Current methods utilize either sequence motifs or structural parameters to detect novel ncRNAs within genomes. Here, we present an ab initio ncRNA finder, named ncRNAscout, by utilizing both sequence motifs and structural parameters. Specifically, our method has three components: (i) a measure of the frequency of a sequence, (ii) a measure of the structural stability of a sequence contained in a t-score, and (iii) a measure of the frequency of certain patterns within a sequence that may indicate the presence of ncRNA. Experimental results show that, given a genome and a set of known ncRNAs, our method is able to accurately identify and locate a significant number of ncRNA sequences in the genome. The ncRNAscout tool is available for downloading at http://bioinformatics.njit.edu/ncRNAscout.
| S-EPMC5054157 | biostudies-literature
Project description:The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats.
| S-EPMC4489287 | biostudies-other