Unknown

Dataset Information

0

Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A Correlation Analysis.


ABSTRACT:

Background

This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.

Methods

Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ 2- and Fisher's tests were used to analyze the genotype-phenotype correlations.

Results

(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype-phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021).

Conclusions

This study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.

SUBMITTER: Han Y 

PROVIDER: S-EPMC7010634 | biostudies-literature | 2020

REPOSITORIES: biostudies-literature

altmetric image

Publications

Pathogenic <i>EDA</i> Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A Correlation Analysis.

Han Yang Y   Wang Xiuli X   Zheng Liyun L   Zhu Tingting T   Li Yuwei Y   Hong Jiaqi J   Xu Congcong C   Wang Peiguang P   Gao Min M  

Frontiers in genetics 20200204


<h4>Background</h4>This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.<h4>Methods</h4>Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. <b>χ</b> <sup>2</sup>- and Fisher's tests were us  ...[more]

Similar Datasets

| S-EPMC3341983 | biostudies-literature
| S-EPMC5015951 | biostudies-literature
| S-EPMC8453221 | biostudies-literature
| S-EPMC11276485 | biostudies-literature
| S-EPMC1684249 | biostudies-literature
| S-EPMC7867966 | biostudies-literature
| S-EPMC4530170 | biostudies-literature
| S-EPMC7999020 | biostudies-literature
| S-EPMC5042395 | biostudies-literature
| S-EPMC3500897 | biostudies-literature