Dataset Information

ALDH1A1 is a marker of astrocytic differentiation during brain development and correlates with better survival in glioblastoma patients.

ABSTRACT: Glioblastoma is the most common malignant brain tumor and patients usually succumb to their disease within 2 years. Aldehyde dehydrogenase 1A1 (ALDH1A1) has been suggested as a marker for cancer stem cells that is associated with poor prognosis in human gliomas. However, little is known about the expression and the function of ALDH1A1 in early stages of brain development. We analyzed ALDH1A1 expression in developing and mature central nervous system (CNS) as well as in 93 cases of primary glioblastomas. Surprisingly, ALDH1A1 was absent in the stem cell niches at varying stages of CNS development, but strong ALDH1A1 expression was observed in mature astrocytes coexpressing GFAP and S100. There were 92 out of 93 glioblastomas (99%) that showed ALDH1A1 protein expression in up to 49% of tumor cells. The majority of these cells co-expressed GFAP, but not established stem cell markers such as Nestin, OLIG2 or SOX2. Finally, strong expression of ALDH1A1 correlated with a significantly better survival of the patients and proved to be an independent prognostic marker in our series (P < 0.01). In contrast to other published data, we therefore provide evidence for ALDH1A1 as a marker of astrocytic differentiation during brain development and of better prognosis in patients suffering from primary glioblastoma.

SUBMITTER: Adam SA

PROVIDER: S-EPMC8057636 | biostudies-literature | 2012 Nov

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

ALDH1A1 is a marker of astrocytic differentiation during brain development and correlates with better survival in glioblastoma patients.

Adam S Alexandra SA Schnell Oliver O Pöschl Julia J Eigenbrod Sabina S Kretzschmar Hans A HA Tonn Jörg-Christian JC Schüller Ulrich U

Brain pathology (Zurich, Switzerland) 20120419 6

Glioblastoma is the most common malignant brain tumor and patients usually succumb to their disease within 2 years. Aldehyde dehydrogenase 1A1 (ALDH1A1) has been suggested as a marker for cancer stem cells that is associated with poor prognosis in human gliomas. However, little is known about the expression and the function of ALDH1A1 in early stages of brain development. We analyzed ALDH1A1 expression in developing and mature central nervous system (CNS) as well as in 93 cases of primary gliobl ...[more]

PMID: 22417385

Similar Datasets

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.

Dataset Information

ALDH1A1 is a marker of astrocytic differentiation during brain development and correlates with better survival in glioblastoma patients.

Publications

ALDH1A1 is a marker of astrocytic differentiation during brain development and correlates with better survival in glioblastoma patients.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets