Dataset Information

Preliminary Exploration of Weekly Peer Group Discussions as a Strategy for Coping with Feelings Associated with Euthanasia in Dairy Caretakers.

ABSTRACT: Dairy caretakers experience a variety of occupational risks including stress related to performing euthanasia and making euthanasia-related decisions for cattle in their care. Few supportive interventions exist to help caretakers cope with euthanasia-related stress. The aim of this study was to assess the impact of weekly peer discussion sessions as an intervention to reduce euthanasia-related stress and grief in dairy caretakers. This study utilized scores from a modified pet-based bereavement questionnaire to assess the change in bereavement of caretakers in response to euthanasia-related stress in a non-treatment group (who did not attend peer discussion sessions, n = 7) and a treatment group (who attended peer discussion sessions, n = 15). Key findings of this study were that discussion sessions did not have a direct impact on the study outcomes as measured using a pet bereavement scale, as there was no difference in the change in bereavement scores during the 8 week study period between the treatment and non-treatment groups. Thematic analysis of peer discussions revealed that compassion towards dairy cattle is a prominent factor in areas of decision making, protocols, and training. Further studies should continue to explore how performing euthanasia and making euthanasia-related decisions impacts caretakers and what supportive interventions can reduce stress and grief.

SUBMITTER: Edwards-Callaway L

PROVIDER: S-EPMC8872095 | biostudies-literature | 2022 Feb

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Preliminary Exploration of Weekly Peer Group Discussions as a Strategy for Coping with Feelings Associated with Euthanasia in Dairy Caretakers.

Edwards-Callaway Lily L Simpson Hailey H Román-Muñiz Noa N Cramer Catie C Mijares Sage S Stallones Lorann L Rivera-Gonzalez Jorge J Aberle Jennifer J

International journal of environmental research and public health 20220215 4

Dairy caretakers experience a variety of occupational risks including stress related to performing euthanasia and making euthanasia-related decisions for cattle in their care. Few supportive interventions exist to help caretakers cope with euthanasia-related stress. The aim of this study was to assess the impact of weekly peer discussion sessions as an intervention to reduce euthanasia-related stress and grief in dairy caretakers. This study utilized scores from a modified pet-based bereavement ...[more]

PMID: 35206363

Similar Datasets

Project description:Timely and humane euthanasia is crucial for animal welfare on swine farms, yet challenges persist in its implementation, particularly in Brazil, where the responsibility often falls to caretakers lacking training. This study aimed to assess the knowledge, attitudes, and practices of swine caretakers regarding euthanasia across non-integrated farms (ranging from 1,000 to 3,500 housed sows) and different experience levels (from less than a month to 40 years working with pigs). A total of 117 people directly working with pigs participated in a survey designed to evaluate their decision-making skills, euthanasia competencies, and understanding of Brazilian guidelines for euthanasia methods. Using Cluster analysis, we identified two distinct groups of caretakers: (1) Empathetic, self-sufficient, apathetic about euthanasia; and (2) Empathetic, knowledge seeker, uncomfortable with euthanasia. Both Clusters exhibited high empathy toward pigs and confidence in identifying sick animals but differed in their attitudes toward euthanasia. The risk factor analysis showed a tendency for younger respondents (under 36 years old) and those from smaller farms (less than 2,000 sows) were more likely to belong to Cluster 2, while older caretakers (over 36 years) and those working on larger farms (more than 2,000 housed sows) tended to belong to Cluster 1. Furthermore, a significant proportion of caretakers lacked knowledge of the euthanasia Brazilian guidelines, as evidenced by incorrect responses regarding acceptable euthanasia methods, such as performing cardiac perforation or using non-penetrating captive bolt guns on growing-finishing pigs. This study highlights the variability in caretaker experience and attitudes toward euthanasia, suggesting a critical need for targeted training programs and euthanasia protocols that address both emotional and practical aspects. Improved understanding of caretaker attitudes can enhance both human and animal welfare on farms.

Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').

Project description:Live streaming is a unique form of media that creates a direct line of interaction between streamers and viewers. While previous research has explored the social motivations of those who stream and watch streams in the gaming community, there is a lack of research that investigates intimate self-disclosure in this context, such as discussing sensitive topics like mental health on platforms such as Twitch.tv. This study aims to explore discussions about mental health in gaming live streams to better understand how people perceive discussions of mental health in this new media context. The context of live streaming is particularly interesting as it facilitates social interactions that are masspersonal in nature: the streamer broadcasts to a larger, mostly unknown audience, but can also interact in a personal way with viewers. In this study, we interviewed Twitch viewers about the streamers they view, how and to what extent they discuss mental health on their channels in relation to gaming, how other viewers reacted to these discussions, and what they think about live streams, gaming-focused or otherwise, as a medium for mental health discussions. Through these interviews, our team was able to establish a baseline of user perception of mental health in gaming communities on Twitch that extends our understanding of how social media and live streaming can be used for mental health conversations. Our first research question unraveled that mental health discussions happen in a variety of ways on Twitch, including during gaming streams, Just Chatting talks, and through the stream chat. Our second research question showed that streamers handle mental health conversations on their channels in a variety of ways. These depend on how they have built their channel, which subsequently impacts how viewers perceive mental health. Lastly, we learned that viewers' reactions to mental health discussions depend on their motivations for watching the stream such as learning about the game, being entertained, and more. We found that more discussions about mental health on Twitch led to some viewers being more cautious when talking about mental health to show understanding.

Dataset Information

Preliminary Exploration of Weekly Peer Group Discussions as a Strategy for Coping with Feelings Associated with Euthanasia in Dairy Caretakers.

Publications

Preliminary Exploration of Weekly Peer Group Discussions as a Strategy for Coping with Feelings Associated with Euthanasia in Dairy Caretakers.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets