Dataset Information

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

ABSTRACT:

Background

The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.

Methods

Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.

Results

In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).

Conclusions

These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

SUBMITTER: Mou JT

PROVIDER: S-EPMC9201170 | biostudies-literature | 2022 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

Mou Jiang-Tao JT Huang Shi-Xing SX Yu Li-Li LL Xu Jing J Deng Qiao-Ling QL Xie Yi-Shan YS Deng Kun K

Annals of translational medicine 20220501 10

<h4>Background</h4>The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.<h4>Methods</h4>Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. ...[more]

PMID: 35722368

Similar Datasets

Project description:BackgroundRecurrent spontaneous abortion (RSA) is defined as two or more consecutive spontaneous abortions before 20 weeks with the same spouse [1]. However, approximately 50% of RSA cases of unknown cause are classified as unexplained recurrent spontaneous abortion (URSA). Potential factors include decreased trophoblast cell migration and invasion, leading to impaired placental implantation and maintenance of the normal maternal-fetal interface. However, the mechanism of this pathogenesis remains unknown. In this study, we investigated the potential role and mechanism of KLF4 in regulating URSA by influencing the invasion and migration ability of trophoblast cells.MethodsWe firstly identified 817 differentially expressed genes by performing a difference analysis of the dataset GSE121950 [2] related to recurrent abortion, and intersected the top 10 genes obtained respectively by the three algorithms: DMNC, MNC, and EPC using Venn Diagram.To detect the expression levels of core genes, villi samples were obtained from normal pregnant women and patients with URSA. RT-qPCR analysis revealed a significant difference in KLF4 mRNA expression and KLF4 was then analyzed. Trophoblast cell lines HTR8 and JEG3 were used to investigate the effect of KLF4 on trophoblastic function. Wound healing and transwell assays was performed to detect the invasion and migration of trophoblast cells. The expression of epithelial-mesenchymal transition(EMT) molecules were detected by RT-qPCR and western blot. Promoter detection and epigenetic modification were detected by chromatin immunoprecipitation (ChIP) assay. Molecular nuclear localization was detected by immunofluorescence and subcellular fractionation. Miscarried mice model was used to study the effects of KLF4 on URSA induced by reduced trophoblast invasion and migration.ResultsKLF4 is highly expressed in the villi of patients with URSA. KLF4 inhibits the expression level of H3R2ME2a in trophoblast cells by regulating the transcriptional level and nuclear translocation of PRMT6, thereby inhibiting the possible regulatory mechanism of trophoblastic invasion and providing a potential treatment strategy for URSA in vivo.ConclusionsThe KLF4/PRMT6/H3R2ME2a axis regulates mechanisms associated with unexplained recurrent spontaneous abortion by regulating trophoblast function.

Project description:Identifying the mechanisms underlying unexplained recurrent spontaneous abortion (URSA) can help develop effective treatments. This study provides novel insights into the biological characteristics and related pathways of differentially expressed genes (DEGs) in URSA. Nineteen patients with URSA and three healthy fertile women with regular menstruation (control group) were recruited. RNA was extracted from the two groups to determine the differential expression of immunoregulatory gene sequences. Gene ontology (GO) and Kyoto Encyclopaedia of Genes and Genomes (KEGG) enrichment analyses were used to identify the biological functions and pathways of the identified DEGs. A protein-protein interaction (PPI) network was constructed using the STRING database. Furthermore, qRT-PCR and ELISA were performed to validate the differential expression of the hub genes. We also explored the regulatory mechanism of Th1/Th2 imbalance. A total of 99 DEGs were identified, comprising 94 upregulated and five downregulated genes. Through GO analysis, nine immune cell function-related clusters were selected, and genes with significant differential expression were primarily enriched in eight immune regulatory functions related to the KEGG signalling pathway. Subsequently, five hub genes (TLR2, CXCL8, IFNG, IL2RA, and ITGAX) were identified using Cytoscape software; qRT-PCR confirmed the differential expression among the hub genes, whereas ELISA revealed a significant difference in extracellular IFN-γ and IL-8 levels. The levels of Th1 (IFN-γ) and the Th1/Th2 ratio were higher in the peripheral blood of URSA patients than in control group patients. These findings suggest that the occurrence of URSA may be associated with the abnormal expression of some specific immunoregulatory genes involved in T-cell activation and differentiation. Among the identified DEGs, IFNG may play a key role in regulating maternal immune response. Although further validation is required, our data provide an important theoretical basis for elucidating the pathogenesis of recurrent spontaneous abortion.

Project description:BackgroundRecurrent spontaneous abortion (RSA) refers to 2 or more consecutive pregnancy losses, and RSA with unknown causes is called unexplained recurrent spontaneous abortion (URSA). Tim-3, a subtype of the T-cell immunoglobulin domain and mucin domain (Tim) protein family, might be an important regulatory molecule that plays a pivotal role in URSA, which might be triggered mostly by Th1/Th2 immune deviation. To understand the etiology and pathogenesis of URSA in Han Chinese women, we investigated the association between polymorphisms of rs10053538 and rs10515746 in the promoter of Tim-3 and the risk of URSA in Han Chinese women.MethodsOne hundred and forty-eight women with RSA resulting in still birth were enrolled in the URSA group. We performed tests to rule out congenital reproductive system malformation, reproductive system tumor, endocrine dyscrasia, and chromosome abnormalities. One hundred and fifty-three women with normal pregnancy leading to live birth were selected at random to comprise the control group. All women included in this study were genetically unrelated Han Chinese women. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele-specific polymerase chain reaction (AS-PCR) were used to determine polymorphisms of rs10053538 and rs10515746, respectively, in all subjects. PCR products were chosen at random for sequencing.ResultsNo significant statistical difference was found between the distribution frequency of the GT + TT genotype and T allele on the rs10053538 locus in the URSA group or the control group (10.1% vs. 11.8%, Chi(2) = 0.205, P = 0.651; 5.1% vs. 6.5%, Chi(2) = 0.592, P = 0.441; respectively). Neither was there a significant difference between the distribution frequency of the GT + TT genotype and T allele on the rs10515746 locus in the groups (6.8% vs. 3.9%, Chi(2)1.201, P = 0.273; 3.4% vs. 2.0%, Chi(2) = 1.169, P = 0.280; respectively).ConclusionsThe present study suggested that these polymorphisms of rs10053538 or rs10515746 in the Tim-3 promoter may not be associated with URSA in Han Chinese women.

Dataset Information

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

Background

Methods

Results

Conclusions

Publications

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets