MIMt-16S- a new 16S rRNA database for archaea and bacteria’s identification

ABSTRACT: MIMt-16S is a database composed by sequences belonging to Fungi from Target Loci type material, Refseq genomes and Genbank genomes. To create MIMt-16S database we collected all the 16S curated sequences from Target Loci and we append the 16S region from all the available genomes in RefSeq predicted with the tool RNAmmer-1.2. The result is a complete database where most of the sequences are manually curated from RefSeq curators and are properly identified at species level, or even subspecies/strain. The full version of MIMt-16S contains in addition small subunit regions from the genome of new archaea and bacteria species deposited in Genbank, always keeping the full 16S region and identifying exactly the species name to get the full taxonomic classification. Thus, all sequences included in both versions of MIMt-16S are full length 16S and are well identified at all taxonomic levels. MIMt-16S has been trained to be used in QIIME and the classifier is also provided. The database format is >SeqIDK__kingdom;P__phylum;C__class;O__order;F__family;G__genus;S__Genus_species CGCGACTACGACTACGCTCAGACGCATCGTACGCAGACTACGTCAGTCAGACGTCGCTGCTCGTCGTACGTACGCT There is also available a file with just the taxonomy associated to each sequence in the format: SeqIDFull_taxonomy and another one with species sharing the 100% of the sequence, so the programs could not differentiate between both species when a taxonomic classification is performed. All files are available for both, only curated version and full version (including also predicted 16S regions from Genbank genomes)

ORGANISM(S): Archaea Bacteria

SUBMITTER:  

PROVIDER: S-BSST2011 | biostudies-other |

REPOSITORIES: biostudies-other