Browse
Submit Data
Databases
API
Help

Dataset Information

3 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Colorectal Cancer Umbrella Protocol - Assessment of Targeted Therapies Against Colorectal Cancer (ATTACC Program) Screening Protocol

ABSTRACT: The goal of this clinical research study is to test for biomarkers in patients with metastatic or unresectable, locally advanced colorectal cancer. Biomarkers are chemical "markers" in the tumor tissue and/or blood that may be related to your reaction to cancer drugs. This is an investigational study. This study’s biomarker testing is for research purposes only. Up to 1280 patients will be enrolled in this study. All will be enrolled at MD Anderson.

DISEASE(S): Colorectal Cancer,Colorectal Neoplasms

PROVIDER: 2094658 | ecrin-mdr-crc |

REPOSITORIES: ECRIN MDR

ACCESS DATA

Json Xml

Similar Datasets

Molecular Determinants of Response to Preoperative Therapy in Patients With Locally Advanced Colorectal Cancer

Project description:The goal of this laboratory research is to look for genes that can predict which patients will achieve a complete disappearance of their colorectal cancer after treatment like chemotherapy, radiation, or other therapy. This is an investigational study. Up to 350 patients will take part in this study. All will be enrolled at MD Anderson.

| 2223183 | ecrin-mdr-crc

Exercise Training Reduces the Inflammatory Response and Promotes Intestinal Mucosa-associated Immunity in Lynch Syndrome patients [GeoMx Digital Spatial Profiling (DSP)]

Project description:This CYCling Lynch patients for Exercise and Prevention (CYCLE-P) trial was a prospective, non-randomized controlled trial conducted at the Familial High-Risk Gastrointestinal and Cancer Prevention Clinic of The University of Texas MD Anderson Cancer Center. Twenty-one LS participants with a confirmed pathogenic mutation in one of four DNA mismatch repair (MMR) genes were enrolled between April 2018 and January 2019. Follow-up was conducted 1-year from the start of the intervention. Statistical analysis by both per-protocol and intention-to-treat was performed from March to May 2021.

2023-08-07 | GSE210011 | GEO

Exercise Training Influences Inflammatory and Immune Systems in Patients at High Risk for Colorectal Cancer: The CYCLE-P Study

2023-08-07 | GSE183150 | GEO

Gene expression profile at single cell level from the colorectal cancer (CRC)

Project description:This study is part of MD Anderson Cancer Center CRC Moon Shot. We used single cell RNAsequencing (scRNA-seq) to analyze the diversity of CRC.

2023-09-25 | GSE231559 | GEO

Rhesus Macaque Model of Mismatch Repair-Deficient Colorectal Cancer

Project description:This SuperSeries is composed of the SubSeries listed below. NIH grant(s): Grant ID: 5 P30 CA016672-44 Grant title: Cancer Center Support Grant Affiliation: The University of Texas MD Anderson Cancer Center Grantor: NCI

2022-03-31 | GSE178383 | GEO

The Beans to Enrich the Gut Microbiome vs. Obesity’s Negative Effects (BE GONE) Trial

Project description:You are being asked to take part in this study because either you are a survivor who has a previous history of colorectal cancer or an MD Anderson patient who had a precancerous colorectal polyp or you have a previous history of colorectal cancer, and you have a current adult body mass index (BMI) score of 25 or higher. The BMI score is used as an indicator of the level of body fat, based on height and weight. The goal of this clinical research study is to learn if eating canned, pre-cooked beans can help improve the levels of healthy bacteria in the digestive system and reduce the effects of obesity on cancer risk. This is an investigational study. Up to 80 participants will be enrolled in this study. All will take part at MD Anderson.

| 2220601 | ecrin-mdr-crc

The MD Anderson Colorectal Cancer Case Control Study

Project description:The MD Anderson Colorectal Cancer Case Control Study

| PRJNA779150 | ENA

The MD Anderson Colorectal Cancer Case Control Study

Project description:The MD Anderson Colorectal Cancer Case Control Study

| PRJNA779120 | ENA

Registry for Women Who Are At Risk Or May Have Lynch Syndrome

Project description:The goal of this study is to create a registry of information about women who have or are at risk for Lynch syndrome, in order to study gynecologic cancer risks. This is an investigational study. Up to 1000 patients will take part in this study. All patients will be enrolled at MD Anderson.

| 2042634 | ecrin-mdr-crc

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data