Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Synthetic data - Genome in a Bottle

ABSTRACT: In May, the National Institute of Standards and Technology (NIST) released its first genome in a bottle, a reference sample of DNA for validating human genome sequences. This so-called truth sequence comes from a decades-old sample donated by a Utah woman for (other) research purposes (NA12878 cell line), which, over the years, has been one of the most studied, and hence best-characterized, human samples. Seeing genomic medicine moving toward mainstream healthcare, researchers at NIST recognized the need for a reference human genome and assembled a private-public consortium in 2012 to create one. As detailed in a 2014 Nature Biotechnology paper (Nat. Biotechnol.32, 246Ã¢Â€Â“251, 2014), the group integrated and arbitrated among sequences from 14 data sets, five sequencing technologies, seven read mappers and three variant callers.

PROVIDER: EGAS00001005591 | EGA |

REPOSITORIES: EGA

ACCESS DATA

Json Xml

Similar Datasets

Acinetobacter oleivorans DR1 : Wild-type cell harboring plasmid (pAST2) in nutrient media

Project description:Transcriptional profiling of A. oleivorans DR1 cells harboring pAST2. Plasmid pAST2 is a tetracycline-resistance plasmid which was isolated from activated sludge (Hong et al., 2014). The complete plasmid sequence was deposited in the National Center for Biotechnology Information (NCBI) GenBank under accession number KC734561 [PMID: 24337108].

2014-02-22 | GSE55239 | GEO

RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

Project description:Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).

2025-02-21 | GSE290209 | GEO

Strand-specific RNA-seq of 13 human tissues from Michael Snyder's lab for the ENCODE project

Project description:This ArrayExpress experiment contains RNA-seq data from human tissues, generated by Michael Snyder's lab at Stanford University as part of the ENCODE project ( https://www.encodeproject.org/search/?type=Experiment ). Sample information was obtained from the ENCODE data coordination center and protocol information was obtained from the associated publication in PNAS (Lin et al., 2014, PubMed ID 25413365). All samples, except for the ovary, were sequenced with technical replicates. The second technical replicate was performed in May 2015 and was not part of the original Lin et al. 2014 publication. Technical replicates are marked in the âComment[technical replicate group]â column of sample-data-relationship format (SDRF) file for this record.

2016-01-21 | E-MTAB-4344 | biostudies-arrayexpress

Targeted gene expression panel for meningiomas

Project description:A custom Nanostring nCounter panel of 100 or 75 meningioma related genes and reference genes was developed, and performed on human frozen and FFPE meningioma samples. This was done as part of a study developing and validating a targeted gene expression biomarker for meningioma outcomes after surgey and benefit from raditherapy.

2023-09-06 | GSE222054 | GEO

Core promoterome of barley embryo [ChIP-seq]

Project description:We define the promotoreome sequence and epigenetic architecture in barley embryos to both put it into evolutionary perspective and to serve as a reference for agricultural and research biotechnology in cereals.

2023-12-07 | GSE227218 | GEO

Core promoterome of barley embryo [CAGE]

2023-12-07 | GSE227214 | GEO

A clinical study to demonstrate bioequivalence between two drugs Xeloda (Reference) and Capecitabine 500 mg Tablets (Test) in cancer patients

Project description:Intervention1: Capecitabine Tablets : Dose & Frequency: 500 mg per day Duration: 3 days (D1, D3, D5) Mode of Administration: Oral Control Intervention1: Capecitabine (Xeloda) Tablets: Dose & Frequency: 500 mg per day Duration: 3 days (D1, D3, D5) Mode of Administration: Oral Primary outcome(s): Establish the bioequivalence of Test vs Reference in relation to the rate and extent of absorption on the basis of the following pharmacokinetic parameters: â?¢Cmax â?¢AUC0tTimepoint: â?¢D1, D3, D5 â?¢D1, D3, D5 Study Design: Other Method of generating randomization sequence:Computer generated randomization Method of allocation concealment:Centralized Blinding and masking:Open Label

| 2573355 | ecrin-mdr-crc

Proteogenomic analysis of Mycobacterium smegmatis using high resolution mass spectrometry

Project description:Biochemical evidence is vital for accurate genome annotation. The integration of experimental data collected at the proteome level using high resolution mass spectrometry allows for improvements in genome annotation by providing evidence for novel gene models, while validating or modifying others. Here we report the results of a proteogenomic analysis of a reference strain of Mycobacterium smegmatis (mc2155), a fast growing model organism for the pathogenic Mycobacterium tuberculosis, the causative agent for Tuberculosis. By integrating high throughput LC/MS/MS proteomic data with genomic six frame translation and ab initio gene prediction databases, a total of 2887 ORFs were identified, including 2810 ORFs annotated to a Reference protein, and 63 ORFs not previously annotated to a Reference protein. Further, the translational start site (TSS) was validated for 558 Reference proteome gene models, while upstream translational evidence was identified for 81. In addition, N-terminus derived peptide identifications allowed for downstream TSS modification of a further 24 gene models. We validated the existence of 6 previously described interrupted coding sequences at the peptide level, and provide evidence for 4 novel frameshift positions. Analysis of peptide posterior error probability (PEP) scores indicate high-confidence novel peptide identifications and indicate that the genome of M. smegmatis is not yet fully annotated.

2016-03-31 | PXD003500 | Pride

Comparison of Agilent SureSelect Focussed Exome and TruSight One Mendeliome sequencing kits using NA12878 trio DNA

Project description:A technical comparison of Agilent SureSelect Focussed Exome and TruSight One Mendeliome sequencing kits, by triplicate sequencing of the cell line DNA of NA12878, NA12891, NA12892 and NIST RM8395

2019-09-20 | E-MTAB-8349 | biostudies-arrayexpress

Discovery of common Asian copy number variants using high-resolution array CGH

Project description:Discovery of common Asian copy number variants using a novel integrated high-resolution array CGH and massively parallel DNA sequencing. We attempted to discover common Asian copy number variants (CNVs) from the DNA of 30 Asian women (10 Korean, 10 CHB (HapMap), 10 JPT (HapMap)) using a custom-designed 24M-oligonucleotide Agilent platform (1.1M X 24 slides). The reference sample for aCGH was NA10851 (HapMap CEPH). In addition to the 30 women, 3 more individuals were analyzed as controls (AK1 (Kim, J.I. et al., 2009 Nature), NA12878 and NA19240).

2010-01-13 | GSE19651 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data