HP Prostate MSK-IMPACT
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina HiSeq 2000
ORGANISM(S): Homo Sapiens
SUBMITTER: MSKCC
PROVIDER: PRJEB33969 | EVA | 2019-08-12
REPOSITORIES: EVA
Dataset's files
Items per page: 5 1 - 5 of 49 |
Similar Datasets
Project description:1134 primary and metastatic colorectal tumor samples sequenced with MSK-IMACT, a hybridization capture-based next-generation sequencing assay. Custom DNA probes were designed for targeted sequencing of all exons and selected introns of 341, 410, or 468 genes.
2017-12-09 | PRJEB23844 | EVA
Project description:Targeted sequencing of genome is essential to the basic biological research and biomedicine. Therefore, various targeted enrichment methods have been developed for this end, in which various hybridization-based methods have been most widely used. However, the current hybridization-based methods (both on solid or in solution) are still restricted by the intrinsic shortcomings of nucleic acid hybridization. In this study, by combining an engineered dCas9-sgRNA with widely used magnetic isolation, we developed a new strategy to enrich target genomic DNAs in high efficiency. In this strategy, target DNA was firstly specifically recognized and bound by a complex of dCas9 and capture sgRNA (csgRNA). The DNA-dCas9-csgRNA complex was then captured on magnetic beads through the annealing of elongated 3′ end of csgRNA with single-stranded capture oligonucleotides coupled on streptavidin-coated magnetic beads. We thus named the strategy as CRISPR-assistant target enrichment (CATE). The enriched DNAs can be analyzed by the next generation sequencing (NGS). We thus named the technique as CATE-seq. Used the technique, we successfully enriched 35 target exons of 6 genes in 6 cell lines by using 54 csgRNA. We found that the target genomic DNA fragments such as exons could be efficiently enriched and analyzed by CATE-seq. The technique has several significant advantages over the current hybridization-based methods, including high simplicity, specificity, sensitivity, and throughput. This study therefore provides a new powerful tool for targeted sequencing.
2018-09-15 | GSE119994 | GEO
Project description:Targeted sequencing of 49 primary medulloblastoma samples using Illumina TruSight Tumor 15 assay
| PRJEB25262 | ENA
Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/
2011-09-12 | E-GEOD-29040 | biostudies-arrayexpress
Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic gene deserts. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/
2011-09-12 | E-GEOD-29038 | biostudies-arrayexpress
Project description:Kallmann syndrome is a genetically heterogeneous condition and a treatable form of male infertility. Defects in KAL1 gene have been implicated in Kallmann syndrome, which can be associated with X-linked ichthyosis in contiguous gene syndromes. In order to uncover the genetic cause of two brothers with Kallmann syndrome and X-linked ichthyosis, a custom semiconductor targeted resequencing panel to detect seventeen Kallmann syndrome causal genes and STS gene was designed. Next-generation sequencing was performed using this panel in the two affected brothers and their normal parents. To validate the result, we applied CytoScan⢠HD array, quantitative real-time PCR and direct PCR electrophoresis analysis with the participants. The patients received clinical assessment, human chorionic gonadotropin treatment and follow-up for 39 months. The results showed that the two affected siblings have the same de novo deletion at Xp22.3 including exons 9-14 of KAL1 gene and entire STS gene but showed different phenotypes in some respects. The secondary sex characteristics of the patients were greatly improved after treatment. We firstly reported that a de novo homozygous deletion contribute to KS with bilateral cryptorchidism and unilateral renal agenesis or normal kidney development and developed a cost-effective and reliable semiconductor targeted resequencing panel for genetic diagnosis of Kallmann syndrome in routinely obtained samples. One of the two brothers with Kallmann syndrome and X-linked ichthyosis was analyzed for validation the results of the deletion detected by next-generation sequencing.
2015-12-05 | E-GEOD-58793 | biostudies-arrayexpress
Project description:<p>Targeted massively parallel sequencing analysis was conducted on DNA extracted from archived 22-28 year old, formalin-fixed primary breast tumors from 625 patents from British Columbia treated with five years of adjuvant tamoxifen monotherapy and followed for over 10 years. Genes were selected for targeted sequencing by review of existing large-scale breast cancer sequencing studies and breast cancer literature. In total, 83 genes were identified and 3,029 probes were designed to tile across all known exons. Illumina sequencing libraries were constructed, indexed, pooled, and enriched for target sequences by hybrid-capture followed by sequencing of paired-end 100bp reads. All samples met minimum quality controls of 80% targeted space covered at 20X or greater. On average, each sample had 336M aligned bases and a mean coverage of 135.8X.</p>
| phs001234 | dbGaP
Project description:Cancer cells metastasize through the bloodstream either as single migratory circulating tumor cells (CTCs) or as multicellular groupings (CTC-clusters). Existing technologies for CTC enrichment are designed primarily to isolate single CTCs, and while CTC-clusters are detectable in some cases, their true prevalence and significance remain to be determined. Here, we developed a microchip technology (Cluster-Chip) specifically designed to capture CTC-clusters independent of tumor-specific markers from unprocessed blood. CTC-clusters are isolated through specialized bifurcating traps under low shear-stress conditions that preserve their integrity and even two-cell clusters are captured efficiently. Highly parallel architecture of the chip allows deterministic screening of clinically relevant volumes of blood samples at slow, and hence, non-damaging flow rates. Using the Cluster-Chip, we identify CTC-clusters in 30-40% of patients with metastatic cancers of the breast, prostate and melanoma. RNA sequencing of CTC-clusters confirms their tumor origin and identifies leukocytes within the clusters as being tissue-derived macrophages. Together, the development of a device for efficient capture of CTC-clusters will enable detailed characterization of their biological properties and role in cancer metastasis. We used the Cluster-Chip to capture CTC-clusters from the blood of a breast cancer patient with high CTC counts, released CTC-clusters in solution, stained them with TexasRed-conjugated antibodies against the leukocyte cell surface markers CD45, CD14 and CD16, and then isolated intact CTC-clusters individually using a micromanipulator. From a single time point, we retrieved 15 CTC-clusters, and each of those clusters was individually subjected to RNA-sequencing analysis using a next generation platform (SOLiD 5500). In addition, two leukocytes were isolated from the blood of a healthy donor were individually subjected to RNA-sequencing analysis using the same platform.
2015-05-17 | E-GEOD-67939 | biostudies-arrayexpress
Project description:We applied the solution hybrid selection approach to the enrichment of CpG islands (CGIs) and promoter sequences from the human genome for targeted high-throughput bisulfite sequencing. A single lane of Illumina sequences allowed accurate and quantitative analysis of 1 million CpGs in more than 21,408 CGIs and 15,946 transcriptional regulatory regions. More than 85% of capture probes successfully yielded quantitative DNA methylation information of targeted regions. In this study, we generated genome-wide, single-base resolution DNA methylation maps in three of the most commonly used breast cancer cell lines.Differentially methylated regions (DMRs) were identified in the 5?-end regulatory regions, as well as the intra- and intergenic regions, particularly in the X chromosome among the three cell lines. The single CpG resolution methylation maps of many known tumor suppressor genes were also established in the three cell lines. Here we present a novel approach that combines solution-phase hybrid selection and massively parallel bisulfite sequencing to profile DNA methylation in targeted CGI and promoter regions. We designed 51,466 single strand DNA oligonucleotides (160-mer) which target 23,441 CGIs and the transcription start sites of 19,369 known genes in the human genome. The synthetic long DNA oligonucleotides were converted into biotinylated RNA probes for solution-phase hybridization capture of target DNA. The captured genomic DNA was treated with sodium bisulfite, amplified by PCR and sequenced using Illumina GA IIx sequencer.
2011-08-01 | E-GEOD-26826 | biostudies-arrayexpress
Project description:Targeted next-generation sequencing of 13 pediatric bithalamic diffuse gliomas. BAM files of targeted next-generation DNA sequencing data of 13 pediatric gliomas, with multi-region sequencing data from 2 of these cases (17 total tumor samples). Genomic DNA was extracted from formalin-fixed, paraffin-embedded blocks of tumor tissue from using the QIAamp DNA FFPE Tissue Kit (Qiagen). Capture-based next-generation DNA sequencing was performed at the University of California, San Francisco Clinical Cancer Genomics Laboratory, using an assay that targets all coding exons of 480 cancer-related genes, select introns of 47 genes, and TERT promoter with a total sequencing footprint of 2.8 Mb (UCSF500 Cancer Panel). Sequencing libraries were prepared from genomic DNA, and target enrichment was performed by hybrid capture using a custom oligonucleotide library (Nimblegen SeqCap EZ Choice). Captured libraries were sequenced as paired-end 100 bp reads on an Illumina HiSeq 2500 instrument. Duplicate sequencing reads were removed computationally to allow for accurate allele frequency determination and copy number calling.
| EGAD00001005499 | EGA