Dataset Information

The early T4 protein, MotB, compacts host DNA and disrupts H-NS dependent repression.

ABSTRACT: Purpose: We investigated the effect of the T4 MotB protein on E. coli gene expression Method: BL21(DE3) E. coli containing either pNW129 or pNW129-MotB were grown to early log phase (OD600 ~ 0.3) then induced with 0.2% arabinose for 20 minutes. Cells were then harvested and total RNA was isolated. The cDNA library was prepared using a modified RNATagSeq workflow as previously described (Shishkin, A.A. et al. 2015 Nat Methods). Optimum fragmentation of the total RNA samples in this library was determined to be 3 min at 94C in FastAP buffer (Thermo Fischer Scientific). The cDNA Library was run on a Bioanalyzer using the Agilent High Sensitivity DNA Kit to evaluate the quality of the library. The concentration of the cDNA library was determined by qPCR using the KAPA Library Quantification Kit (Kapa Biosystems, Wilmington, MA, USA) and CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Sequencing was performed by the NIDDK Genomics Core facility using a MiSeq system with the single-end 50 bp Sequencing Kit (Illumina, San Diego, CA, USA). RNA-seq data was processed as previously described using E. coli B str. DE3 (NC_012971.2) as the reference genome. Differential expression between conditions was represented as a fold change, and genes with both a fold change ≥2 and adjusted p value ≤ 0.05 were considered significant. Results: RNA-seq data revealed that the expression of genes encoded in the cryptic prograge Lambda DE3 as well as an additional 29 of E. coli genes were significantly increased after motB expression. Conclusion: T4 MotB is a DNA binding protein that compacts host DNA and disrupts H-NS dependent repression.

ORGANISM(S): Escherichia coli BL21(DE3)

PROVIDER: GSE152170 | GEO | 2020/06/11

REPOSITORIES: GEO

ACCESS DATA

Similar Datasets

Project description:Purpose: We investigated how deletion of DksA or ppGpp, two E. coli global transcription regulators, affects T4 infection. Method: B606, B606 DdksA, and B606 ppGpp0 were grown at 37C to early/mid log phase (OD600 ~ 0.4) then infected with moi of 10 of either wt T4 or T4motAam and total RNA was isolated. 2.5 µg total RNA from each sample was treated with a Ribo-Zero rRNA Removal Kit (Gram-Negative Bacteria; Illumina San Diego, CA) to deplete rRNA. The enriched mRNA was fragmented, reverse-transcribed, ligated with dual indexes, and amplified using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). The resulting RNA-Seq libraries were pooled at equal concentrations and sequenced using on an Illumina MiSeq to generate 2 x 100 bp paired-end reads. Read data in fastq format was demultiplexed and aligned to E. coli B str. DE3 (NC_012971.2) reference genome using STAR v2.5.2, retaining unmapped reads (Dobin, Davis et al. 2013). Unmapped reads were then mapped in a second step to T4 reference (NC_000866.4). In both cases, default alignment behavior was altered with the following arguments: --outFilterScoreMinOverLread 0 --outFilterMatchNmin 30 --outFilterMatchNminOverLread 0 --clip3pAdapterSeq AGATCGGAAGAGCGTCGTGTA --alignIntronMax 1. RNA gene counts in both reference genomes were then quantified using the same NCBI gene definitions utilized in mapping index construction using the subread featureCounts v1.4.6-p3 package (Liao, Smyth et al. 2014). Differential expression between samples fchanges in gene expression was predetermined to entail a fold change of more than or equal to 2 and P value less than or equal to 0.05. at 5 minutes post-infection. Result: Both ppGpp0 and delta(dksA) increase wt T4 plaque size. However, ppGpp0 does not significantly alter burst size/latent period and only modestly affects T4 transcript abundance, while delta(dskA) increases burst size (2-fold), does not affect latent period, and increases the abundance of several Pe RNAs at 5 min post-transcription. delta(dskA) also increases T4motAam plaque size with a much shorter latent period compared to T4motAam/wt infection, and the levels of specific middle RNAs increase due to more transcription from Pe's that extend into these middle genes. Conclusion: We conclude that DksA attenuates T4 early gene expression. Consequently, delta(dksA) results in a more productive wt infection and ameliorates the poor expression of middle genes in a T4motAam infection.

Project description:Introduction: Inflammatory bowel disease (IBD) is a complex multi-factorial disease for which physiologically relevant in vitro models are lacking. Existing models are often a compromise between biological relevance and scalability. Here, we integrated intestinal epithelial cells (IEC) derived from human intestinal organoids from 3 different donors in a gut-on-a-chip platform to model the human intestine and key aspects of IBD. The goal of our transcriptomics experiment was to compare microfluidic-grown IEC to donor-paired HIO cultures in standard Matrigel droplets used for gut-on-a-chip seeding. Methods: For the microfluidic gut-on-a-chip, IEC cells were seeded in the top channel of a 3-lane OrganoPlate on top of a Collagen I gel embedded in the middle channel. Cells were kept in HISC medium devoid of A83-01 for 2 days, before medium was switched back to HISC medium. 6 days after seeding, cells were triggered with LPS 100ng/mL, IFN-γ 20ng/mL for 24 hours. RNA was isolated with TRI-reagent followed by a phenol-chloroform extraction. For the static Matrigel-grown HIO, RNA was isolated of confluent cultures with TRI-reagent followed by a phenol-chloroform extraction. Library preparations, sequencing reactions were conducted at GENEWIZ, LLC. (South Plainfield, NJ, USA). RNA samples were quantified using Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA) and RNA integrity was checked with 4200 TapeStation (Agilent Technologies, Palo Alto, CA, USA). rRNA depletion was performed using Ribozero rRNA Removal Kit (Illumina, San Diego, CA, USA). RNA sequencing library preparation used NEBNext Ultra RNA Library Prep Kit for Illumina by following the manufacturer’s recommendations (NEB, Ipswich, MA, USA). Briefly, enriched RNAs were fragmented for 15 minutes at 94 °C. First strand and second strand cDNA were subsequently synthesized. cDNA fragments were end repaired and adenylated at 3’ends, and universal adapter was ligated to cDNA fragments, followed by index addition and library enrichment with limited cycle PCR. Sequencing libraries were validated using the Agilent Tapestation 4200 (Agilent Technologies, Palo Alto, CA, USA), and quantified by using Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA) as well as by quantitative PCR (Applied Biosystems, Carlsbad, CA, USA). The sequencing libraries were multiplexed and clustered on one lane of a flowcell and loaded on the Illumina HiSeq instrument according to manufacturer’s instructions. The samples were sequenced using a HiSeq 2x150 Paired End (PE) configuration. Image analysis and base calling were conducted by the HiSeq Control Software (HCS). Raw sequence data (.bcl files) generated from Illumina HiSeq was converted into fastq files and de-multiplexed using Illumina's bcl2fastq 2.17 software. One mis-match was allowed for index sequence identification.

Dataset Information

The early T4 protein, MotB, compacts host DNA and disrupts H-NS dependent repression.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure