Transcriptomics

Dataset Information

0

Manipulation of Mir140 3p and 5p expression


ABSTRACT: The goal of this study was to change the stoichiometry of Mir140-3p and Mir140-5p expression, thereby increasing the expression levels of Mir140-5p, and observe the biological effects on skeletal development. This was done by introducing two types of nucleotide changes into the seed regions of Mir140. The first was by changing the initial bases of Mir140-3p from 'TACCACAGGGTAGAACCACGGACAGGGTACTGGAGC' to 'CGCCACAGGGTAGAACCACGGACAGGGTACTGGAGC' lowering the expression levels of Mir140 3p and disrupting its function. The second change to alter Mir140 expression was by changing the Mir140-5p seed region from 'CAGTGGTTTTACCCTATGGAGG' to 'TAGTGGTTTTACCCTATGGAGG' increasing mi140-5p's ability to be bound by Argonaute.

ORGANISM(S): Mus musculus

PROVIDER: GSE162266 | GEO | 2020/11/28

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

| PRJNA681217 | ENA
2020-07-17 | GSE144367 | GEO
2018-06-30 | GSE101811 | GEO
2023-01-26 | GSE223538 | GEO
2024-12-11 | PXD041087 | Pride
2025-07-25 | PXD053397 | Pride
2016-05-23 | GSE74296 | GEO
2023-05-10 | PXD036109 | Pride
2024-01-11 | GSE227354 | GEO
2020-09-01 | GSE124398 | GEO