Dataset Information

RNAseq of hnRNPC and ADAR deficient THP-1

ABSTRACT: Endogenous double-stranded RNA is prevented from activating the cytosolic antiviral receptor MDA5 by adenosine-to-inosine editing by ADAR. Consequently, CRISPR/cas9 targeting ADAR in the human monocytic cell line THP-1 induces a spontaneous MDA5-dependent interferon response. This response is synergistically enhanced by concomitant CRISPR/cas9 targeting of hnRNPC. For this study, cas9 transgenic THP-1 were nucleofected with combinations of control gRNA, ADAR gRNA or hnRNPC gRNA to elucidate the basis for synergistic interferon-stmulated gene induction by combined ADAR and hnRNPC targeting. As a control for interferon-stimulated gene induction, IFN-alpha treated THP-1 were included, as well. To investigate potential interferon inducing mechanisms, we quantified gene expression, intron expression as well as the expression of regions rich in adenosine-to-inosine editing clusters. In a second part, nuclear vs cytosolic distribution of RNA rich in adenosine-to-inosine clusters was investigated by sequencing of total RNA or RNA from cytosolic and nuclear extracts of ADAR and/or hnRNPC targeted cells. In the first part of the study, STING-deficient, cas9 transgenic THP-1 were nucleofected with combinations of control, GFP-targeting, ADAR-targeting or hnRNPC-targeting gRNA and cells collected for total RNA extraction on days three, four and five after nucleofection. In addition, another control-nucleofected sample was treated on day 3 for 24 h. The experiment was repeated three times leading to three replicates per condition. In the second part, WT cas9-transgenic THP-1 were nucleofected with combinations of control, ADAR-targeting or hnRNPC-targeting gRNA and cells were either collected for total RNA extraction or separated into digitonin-soluble (cytosolic) and digitonin-resistant (nuclear and mitochondrial) compartments and then RNA extracted. The experiment was repeated twice leading to two replicates per condition. Differential gene expression analysis confirmed synergistic induction of interferon-stimulated genes. RNA-seq analysis demonstrated dysregulation of Alu-containing introns in hnRNPC-deficient cells via utilization of unmasked cryptic splice sites, including introns containing ADAR-dependent A-to-I editing clusters or regions enriched in editing clusters (ECRs) in general. These putative MDA5 ligands showed reduced editing in the absence of ADAR, providing a plausible mechanism for the combined effects of hnRNPC and ADAR. Part 2 of the study confirmed cytosolic access of a subset of ECRs to the cytosol.

ORGANISM(S): Homo sapiens

PROVIDER: GSE176012 | GEO | 2021/07/16

REPOSITORIES: GEO

ACCESS DATA

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

RNAseq of hnRNPC and ADAR deficient THP-1

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure