Dataset Information

The WNT-dependent gating of MYC requires non-canonical functions of a distal CTCF binding site

ABSTRACT: Abnormal WNT signaling increases MYC expression in colon cancer cells in part via oncogenic super-enhancer (OSE)-mediated gating of MYC to the nuclear pore. This process enables MYC transcripts to escape the higher degradation rate in the nucleus compared to the cytoplasm. By targeted mutation, we show here that a single OSE-specific CTCF binding site (CTCFBS) mediates the WNT-regulated increased nuclear export rate of mRNAs derived from its interacting MYC and FAM49B loci, located >0.5 and >2.6 mbp distal of the OSE. The CTCFBS coordinated OSE-MYC proximity with their peripheral localisation, and mediated the WNT-dependent recruitment of the nuclear pore anchor AHCTF1 to the OSE. Furthermore, the CTCFBS up-regulated CCAT1 eRNA transcription, implicated in OSE-MYC interactions, correlating with an enhanced ability of the OSE to reach the nuclear periphery. We submit that WNT-dependent gating of MYC requires CTCF complexed with the OSE to coordinate multiple steps of the gating process.

ORGANISM(S): Homo sapiens

PROVIDER: GSE182626 | GEO | 2021/11/08

REPOSITORIES: GEO

ACCESS DATA

Similar Datasets

Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.

Dataset Information

The WNT-dependent gating of MYC requires non-canonical functions of a distal CTCF binding site

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure