Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

3C-seq of HT29 cells with CCAT1-L knockdown or scramble knockdown


ABSTRACT: CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.

ORGANISM(S): Homo sapiens

SUBMITTER: Li Yang 

PROVIDER: E-GEOD-55261 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

altmetric image

Publications

Human colorectal cancer-specific CCAT1-L lncRNA regulates long-range chromatin interactions at the MYC locus.

Xiang Jian-Feng JF   Yin Qing-Fei QF   Chen Tian T   Zhang Yang Y   Zhang Xiao-Ou XO   Wu Zheng Z   Zhang Shaofeng S   Wang Hai-Bin HB   Ge Junhui J   Lu Xuhua X   Yang Li L   Chen Ling-Ling LL  

Cell research 20140325 5


The human 8q24 gene desert contains multiple enhancers that form tissue-specific long-range chromatin loops with the MYC oncogene, but how chromatin looping at the MYC locus is regulated remains poorly understood. Here we demonstrate that a long noncoding RNA (lncRNA), CCAT1-L, is transcribed specifically in human colorectal cancers from a locus 515 kb upstream of MYC. This lncRNA plays a role in MYC transcriptional regulation and promotes long-range chromatin looping. Importantly, the CCAT1-L l  ...[more]

Similar Datasets

2014-02-22 | GSE55261 | GEO
| PRJNA239020 | ENA
2021-01-18 | PXD019487 | Pride
2013-12-16 | E-GEOD-42961 | biostudies-arrayexpress
2016-08-15 | E-MTAB-4845 | biostudies-arrayexpress
2024-04-11 | GSE207452 | GEO
2020-11-02 | GSE129378 | GEO
2024-04-11 | GSE208323 | GEO
2015-01-02 | E-GEOD-61814 | biostudies-arrayexpress
2014-01-15 | E-GEOD-52281 | biostudies-arrayexpress