Transcriptomics

Dataset Information

0

Transcriptome profiling of DDX3X/DDX3Y dependency after DDX3X gRNA targeting in KNS-42 parental cell lines, and rescue experiments with DDX3X or DDX3Y overexpressing cells (PACT).


ABSTRACT: Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.

ORGANISM(S): Homo sapiens

PROVIDER: GSE190507 | GEO | 2022/04/06

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

2022-06-01 | GSE193783 | GEO
| PRJNA787308 | ENA
2022-06-01 | GSE171792 | GEO
2022-11-26 | MSV000090789 | MassIVE
2021-09-01 | GSE143393 | GEO
2021-09-01 | GSE144983 | GEO
| PRJNA797960 | ENA
| PRJNA720922 | ENA
| PRJNA605444 | ENA
| S-EPMC11839027 | biostudies-literature