Other

Dataset Information

0

High-throughput sequencing of in vitro fecal fermentation samples


ABSTRACT: We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

ORGANISM(S): human feces metagenome

PROVIDER: GSE199749 | GEO | 2022/04/02

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

2025-07-04 | E-MTAB-15306 | biostudies-arrayexpress
2022-07-27 | GSE208665 | GEO
2020-10-01 | GSE142516 | GEO
2019-02-08 | GSE98944 | GEO
2021-07-21 | GSE180131 | GEO
2025-06-04 | GSE275090 | GEO
| PRJNA1154272 | ENA
2012-04-24 | E-GEOD-35587 | biostudies-arrayexpress
2026-05-30 | E-MTAB-16487 | biostudies-arrayexpress
2022-06-01 | GSE198095 | GEO