High-throughput sequencing of in vitro fecal fermentation samples
Ontology highlight
ABSTRACT:
ORGANISM(S): human feces metagenome
PROVIDER: GSE199749 | GEO | 2022/04/02
REPOSITORIES: GEO
Similar Datasets
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Purpose: The aim of this study is to investigate enhancer promoter interactions in skeletal muscle Methods: 50 ng of purified DNA were used as a template for PCR with bait-specific primers (Table S5) containing Illumina adapter termini. PCR reactions were pooled and, after primer removal with 1.8x AMPure XP beads, DNA was sequenced with the HiSeq 4000 (Illumina), as single-end 50 bp reads. Sequences were trimmed to remove primer and bait fragment sequence with the sabre tool (https://github.com/najoshi/sabre), mapped to the genome with Bowtie and converted to restriction fragment space as in van de Werken et al., 2012 (van de Werken et al., 2012). Interactions were called on single 4C experiments with peakC (Geeven et al., 2018), using a sliding window of 21 fragments.
2020-10-01 | GSE142516 | GEO
Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
2019-02-08 | GSE98944 | GEO
Project description:A cDNA library was constructed by Novogene (CA, USA) using a Small RNA Sample Pre Kit, and Illumina sequencing was conducted according to company workflow, using 20 million reads. Raw data were filtered for quality as determined by reads with a quality score > 5, reads containing N < 10%, no 5' primer contaminants, and reads with a 3' primer and insert tag. The 3' primer sequence was trimmed and reads with a poly A/T/G/C were removed
2021-07-21 | GSE180131 | GEO
Project description:The tracks show enrichment of RNA sequence tags generated by high throughput sequencing (RNA-seq) and mapped to the human genome. Double stranded cDNA was synthesized from polyadenylated RNA (polyA+) . PCR amplified, adapter ligated cDNA, 150-300nt long, was sequenced on an Illumina GA sequencer. Where designated, cell lines received specific treatments prior to RNA isolation. As indicated, K562 cells were treated with either interferon-a or interferon-g for 30 minutes or 6 hours. These experiments were carried out in conjunction with ChIP-Seq experiments on the transcription factors STAT1 and STAT2 in order to examine the effects that inducers of a specific transcriptional response might have on gene expression and on transcription factor binding site discovery. K562 cells were treated with a-amanitin in order to examine the effects of RNA polymerase II inhibition on RNA polymerase III-mediated transcription. This track shows expression data generated as confirmation of the SYDH TFBS (http://genome-preview.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&g=wgEncodeSydhTfbs) tracks currently available on genome-preview. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf Cells were grown according to the approved ENCODE cell culture protocols (http://hgwdev.cse.ucsc.edu/ENCODE/protocols/cell). Total RNA was extracted using TRIzol reagents (15596-018, Life Tech), following the manufacturer's protocol. For polyA+ samples, polyadenylated RNA was purified using the MicroPoly(A) Purist kit (AM1919, Life Tech) and fragmented using RNA Fragmentation Reagent (AM8740, Life Tech). Illumina adapters were ligated to double stranded cDNA which was synthesized using reagents from Life Tech (11917-010). PCR amplified adapter ligated cDNA (150-300 bp) was sequenced using Illumina GA. Sequence reads of 27-33nt long with 0-2 mismatches were mapped to the genome. The signal height corresponds to the number of overlapping fragments at each nucleotide position in the genome. Samples originally mapped to the hg18 version of the human genome were remapped to hg19 using the BWA aligner, version 0.5.7.
2012-04-24 | E-GEOD-35587 | biostudies-arrayexpress
Project description:The purified RNA from NFs (n=1) and KFs (n=1) treated with DMSO or ASC-J9 was used for the preparation of the sequencing library by the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s recommendations. Briefly, mRNA was purified from total RNA (1 µg) by oligo(dT)-coupled magnetic beads and fragmented into small pieces under elevated temperature. The first-strand cDNA was synthesized using reverse transcriptase and random primers. After the generation of double-strand cDNA and adenylation on the 3’ ends of DNA fragments, the adaptors were ligated and purified with the AMPure XP system (Beckman Coulter, Beverly, USA). The quality of the libraries was assessed by the Agilent Bioanalyzer 2100 system and a real-time PCR system. The qualified libraries were then sequenced on an Illumina NovaSeq 6000 platform with 150-bp paired-end reads generated by Genomics BioSci & Tech Co., Ltd.
2022-06-01 | GSE198095 | GEO
Project description:Total RNA was extracted using TRI® Reagent (Sigma). cDNA was synthesized by RevertAid™ First Strand cDNA Synthesis Kit with Oligo dT primers (K1622, Fermentas) following manufacturer’s recommendations. PCR reactions were carried out on a DNAEngine® Thermal Cycler (PTC-0200G, Bio-Rad) in 25 μl reaction volume containing 1 μl cDNA, 200 nM primer pairs and components of TaKaRa Taq™ kit (R001A, Takara). All samples were analyzed in triplicate RT-qPCR.mRNAs were extracted using biotinylated poly(dT) oligo, followed by further removing of contaminated rRNA using RiboMinus Transcriptome Isolation Kit (K1550-02, Invitrogen). Then mRNAs were fragmented into 100-200nt length and subjected to immunoprecipitation with m6A specific antibody.The libraries were sequenced using HiSeq2000 (Illumina) in single-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used and samples were multiplexed in two samples per lane.
2015-03-09 | GSE53244 | GEO
Project description:Cassava Peel Heap samples Metagenome
| PRJNA488516 | ENA
Project description:To analyse gene expression pattern in different disease state of COVID-19 patients. Experimental workflow: 1) Small RNA enrichment and purification, 2) Adaptor ligation and Unique molecular identifiers (UMI) labeled Primer addition, 3) RT-PCR, Library quantitation and pooling cyclization, 4) Library quality control, 5) Small RNAs were sequenced by BGI500 platform with 50bp single-end reads resulting in at least 20M reads for each sample. Analysis steps: 1) Small RNA raw sequencing reads with low quality tags (which have more than four bases whose quality is less than ten, or have more than six bases with a quality less than thirteen.), the reads with poly A tags, and the tags without 3’ primer or tags shorter than 18nt were removed. 2) After data filtering, the clean reads were mapped to the reference genome and other sRNA database including miRbase, siRNA, piRNA and snoRNA using Bowtie2 (Langmead and Salzberg, 2012). Particularly, cmsearch (Nawrocki and Eddy, 2013) was performed for Rfam mapping. 3) The small RNA expression level was calculated by counting absolute numbers of molecules using unique molecular identifiers (UMI, 8-10nt). MiRNA with UMI count lager than 1 in at least one sample were considered as expressed.
2021-03-24 | E-MTAB-10299 | biostudies-arrayexpress
Project description:The quality of the pepper fruit is significantly influenced by the properties of its surface such as color, glossiness and texture. The fruit surface is composed of a peel containing several layers including the cuticle, epidermis and the hypodermis. The peel acts as a protective barrier against biotic and abiotic stresses and is the most critical tissue affecting water loss during post harvest storage. The peel is composed of an outer epidermis with thick waxy (lipid) cuticle and few cell layers of thick-walled hypodermal cells. Despite its agronomic importance and due to the fact that the majority of studies in fruits have been conducted using flesh and peel tissues as a whole, the biochemical and genetic bases of variation in peel properties are largely unknown. In this proposal we aim to determine peel-specific gene expression in pepper by micro array hybridizations of peel and flesh RNA extracted at different developmental stages of the fruit. The cultivar Celica (Capsicum annuum) that has a large blocky fruit will be used for studying gene expression in the peel and flesh. Plants were grown in the greenhouse during the spring of 2006. Fruits were harvested at three developmental stages: young- 10 days after anthesis, mature green- 30 days after anthesis and ripe red- 45 days after anthesis. These stages were chosen because each represents a distinct phase in fruit development. At each stage, a biological replicate consists of bulked tissue from 3 fruits from each of 3 plants (a total of 9 fruits). We have a total of 4 biological replicates. For each fruit, the peel was separated from the flesh by manual dissection using thin forceps and scalpel blade. Peel and flesh samples were immediately frozen in liquid nitrogen and stored at -800C until RNA extraction. Total RNA was extracted using the GenElute Mammalian Total RNA Miniprep kit (Sigma). Keywords: Reference design
2007-09-01 | GSE8282 | GEO