Other

Dataset Information

0

Hhigh-throughput sequencing of in vitro fecal fermentation samples


ABSTRACT: We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

ORGANISM(S): feces metagenome

PROVIDER: GSE208665 | GEO | 2022/07/27

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

2022-04-02 | GSE199749 | GEO
2026-01-26 | GSE317110 | GEO
2026-01-28 | GSE291841 | GEO
| PRJNA976046 | ENA
2025-06-15 | GSE298403 | GEO
2024-09-23 | GSE222533 | GEO
2022-01-24 | GSE194127 | GEO
2018-08-23 | GSE102981 | GEO
2018-06-27 | E-MTAB-6216 | biostudies-arrayexpress
2019-03-29 | PXD006033 | Pride