Hhigh-throughput sequencing of in vitro fecal fermentation samples
Ontology highlight
ABSTRACT:
ORGANISM(S): feces metagenome
PROVIDER: GSE208665 | GEO | 2022/07/27
REPOSITORIES: GEO
Similar Datasets
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:A metaproteomics analysis was conducted on the infant fecal microbiome to characterize global protein expression in 8 samples obtained from infants with a range of early-life experiences. Samples included breast-, formula- or mixed-fed, mode of delivery, and antibiotic treatment and one set of monozygotic twins. Although label-free mass spectrometry-based proteomics is routinely used for the identification and quantification of thousands of proteins in complex samples, the metaproteomic analysis of the gut microbiome presents particular technical challenges. Among them: the extreme complexity and dynamic range of member taxa/species, the need for matched, well-annotated metagenomics databases, and the high inter-protein sequence redundancy/similarity between related members. In this study, a metaproteomic approach was developed for assessment of the biological phenotype and functioning, as a complement to 16S rRNA sequencing analysis to identify constituent taxa. A sample preparation method was developed for recovery and lysis of bacterial cells, followed by trypsin digestion, and pre-fractionation using Strong Cation Exchange chromatography. Samples were then subjected to high performance LC-MS/MS. Data was searched against the Human Microbiome Project database, and a homology-based meta-clustering strategy was used to combine peptides from multiple species into representative proteins. Bacterial taxonomies were also identified, based on species-specific protein sequences, and protein metaclusters were assigned to pathways and functional groups. The results obtained demonstrate the applicability of this approach for performing qualitative comparisons of human fecal microbiome composition, physiology and metabolism, and also provided a more detailed assessment of microbial composition in comparison to 16S rRNA.
2019-03-29 | PXD006033 | Pride
Project description:We developed a high-throughput mutagenesis screen to comprehensively identify the cis-regulatory elements that control a target splicing event from the MST1R gene that codes for the RON receptor tyrosine kinase. Skipping of alternative exon 11 results in a constitutively active isoform that promotes epithelial to mesenchymal transition and thereby contributes to the invasive phenotype of tumors. First, we created a library of mutated minigenes via mutagenic PCR. Importantly, the reverse primer introduced a random barcode sequence which labels the associated mutations. Next, the plasmid library was transfected as a pool and depending on the mutations, the transcripts exhibit changes in alternative splicing. The minigene library and the splicing outcome were analyzed by next-generation sequencing and subsequent integration of the datasets resulted in a map of splicing regulatory sites. The RNA-seq experiment was performed to quantify the transcript isoforms and sequence their associated barcodes in order to characterize the splicing outcome of the minigene library in HEK293T cells. For preparation of high-throughput RNA sequencing (RNA-seq) libraries, the total RNA obtained from transfected HEK293T cells was enriched for mRNA by performing polyA selection of 20 µg of total RNA using Dynabeads® Oligo (dT)25 beads (Invitrogen) according to the manufacturer’s protocol. Reverse transcription was carried out using 500 ng of enriched mRNA under the abovementioned conditions. To prevent the formation of chimeric amplicons, the libraries were amplified using emulsion PCR (PMID: 16791213), with Phusion DNA Polymerase (NEB) and either cDNA derived from polyA-selected RNA in the case of RNA-seq or plasmid DNA of the minigene library in the case of high-throughput DNA sequencing (DNA-seq). To amplify fragments for RNA-seq, the following primers containing Illumina sequencing adaptors were used: 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTNNNNNNNNNNGTTCCACTGAAGCCTGAG-3′ (forward primer) and 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNATAGAATAGGGCCCTCTAGA-3′ (reverse primer). PCR products were purified using Agencourt AMPure XP beads (Beckman Coulter). Purified products were first analysed with the TapeStation 2200 capillary gel electrophoresis instrument (Agilent) and then fluorimetrically quantified using a Qubit fluorimeter (Thermo Scientific). Sequencing was carried out on the Illumina MiSeq platform using paired-end reads of 300 nt length and a 10% PhiX spike-in to increase sequence complexity.
2018-06-27 | E-MTAB-6216 | biostudies-arrayexpress
Project description:Primases are key enzymes involved in DNA replication. They act on single-stranded DNA, and catalyze the synthesis of short RNA primers used by DNA polymerases. Here, we investigate the DNA-binding and functional activity of the bacteriophage T7 primase using a new workflow called High-Throughput Primase Profiling (HTPP). Using a unique combination of high-throughput binding assays and biochemical analyses, HTPP reveals a complex landscape of binding specificity and functional activity for the T7 primase, determined by sequences flanking the primase recognition site. We identified specific features, such at G/T-rich flanks, which in-crease primase-DNA binding up to 10-fold and, surprisingly, also increase the length of newly formed RNA (2-3 fold). To our knowledge, variability in primer length has not been reported for this primase. We expect that applying HTPP to additional enzymes will reveal new insights into the effects of DNA sequence composition on the DNA recognition and functional activity of primases.
2018-08-23 | GSE102981 | GEO
Project description:The aim of study is to evaluate whether salidroside (S), tyrosol (T) and hydroxytyrosol (H) which are dietary phenylethanoids of natural origins have an influence on reversing gut dysbiosis induced by metabolic syndrome (MetS) mice. C57 BL/6J female mice induced by high fructose diet were established. All mice were adapted to the environment for 7 days with normal diet and sterile drinking water (DW), and randomly divided into 6 groups. Mice in the ND group are fed with ND and treated with normal saline. Other groups were fed with high fructose (HFru) by administration of normal saline, salidroside (S), tyrosol (T) or hydroxytyrosol (H) for 12 weeks by intragastric gavage. Fresh feces from each mouse were collected one days before the end of the experiment and temporarily placed in sterile tubules, and then snap-frozen in liquid nitrogen. Total DNA from stool bacteria was extracted using QIAamp DNA stool mini kit from Qiagen (Germantown, MD, USA) according to the manufacturer’s instructions. Illumina HiSeq sequencing analysis of the DNA samples.16S rRNA gene sequence data further revealed that S, T and H could enhance the diversity of gut microbiota. In general, the abundance of Shigella, Acinetobacter, Lactobacillus, Staphylococcus and Sporosarcina had changed significantly. These findings suggest that S, T and H probably suppress lipid accumulation and to hepatoprotective effect and improve intestinal microflora disorders to attenuate metabolic syndromes.
2022-01-24 | GSE194127 | GEO
Project description:mice fecal 16S rDNA amplication Raw sequence reads
| PRJNA543965 | ENA
Project description:Human fecal samples microbial 16S rRNA gene sequence
| PRJEB39539 | ENA
Project description:We characterized the bacterial diversity of chlorinated drinking water from three surface water treatment plants supplying the city of Paris, France. For this purpose, we used serial analysis of V6 ribosomal sequence tag (SARST-V6) to produce concatemers of PCR-amplified ribosomal sequence tags (RSTs) from the V6 hypervariable region of the 16S rRNA gene for sequence analysis. Using SARST-V6, we obtained bacterial profiles for each drinking water sample, demonstrating a strikingly high degree of biodiversity dominated by a large collection of low-abundance phylotypes. In all water samples, between 57.2-77.4% of the sequences obtained indicated bacteria belonging to the Proteobacteria phylum. Full-length 16S rDNA sequences were also generated for each sample, and comparison of the RSTs with these sequences confirmed the accurate assignment for several abundant bacterial phyla identified by SARST-V6 analysis, including members of unclassified bacteria, which account for 6.3-36.5% of all V6 sequences. These results suggest that these bacteria may correspond to a common group adapted to drinking water systems. The V6 primers used were subsequently evaluated with a computer algorithm to assess their hybridization efficiency. Potential errors associated with primer-template mismatches and their impacts on taxonomic group detection were investigated. The biodiversity present in all three drinking water samples suggests that the bacterial load of the drinking water leaving treatment plants may play an important role in determining the downstream community dynamics of water distribution networks. 3 different drinking water samples (Orly, Ivry, Joinville drinking water sample)
2009-01-07 | E-GEOD-14318 | biostudies-arrayexpress
Project description:Genomic DNA of intracranial aneurysm and matched superficial temporal artery from same patient (n=9) was extracted with QIAamp DNA Mini Kit (Qiagen, Valencia, CA). A total of 500 of genomic DNA was bisulfite conversion using the EZ DNA Methylation Gold Kit (Zymo Research, Irvine, CA) and then analyzed on an Infinium HumanMethylation450 BeadChip (Illumina, San Diego, CA) following the manufacturer’s instructions.
2016-12-01 | GSE75434 | GEO