Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

De novo inference of thermodynamic binding energies using deep learning models of in vivo transcription factor binding

ABSTRACT: We introduce Affinity Distillation (AD), a method for extracting thermodynamic affinities de-novo from in-vivo immunoprecipitation experiments using deep learning. We show that neural networks modeling base-resolution in-vivo binding profiles of yeast and mammalian TFs can accurately predict energetic impacts of varying underlying DNA sequence on TF binding. Systematic comparisons between Affinity Distillation predictions and other predictive algorithms consistently show that Affinity Distillation more accurately predicts affinities across a wide range of TF structural classes and DNA sequences. Affinity Distillation relies on in-silico marginalization against many sequence backgrounds, resulting in a higher dynamic range and more accurate predictions than motif discovery algorithms. Moreover, we show that Affinity Distillation can learn differential paralog-specific affinities, thereby making it possible to more accurately reconstruct regulatory networks in cells.

ORGANISM(S): Saccharomyces cerevisiae

PROVIDER: GSE207001 | GEO | 2022/06/29

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Synthetic genetic circuit reveals overlapping binding sites underlie TF genomic occupancy

Project description:Sequence-specific DNA binding by transcription factors (TFs) is required for accurately regulating target gene expression. However, rules governing TF-DNA interactions remain elusive because current high-throughput approaches to map them fail to identify lower-affinity interactions. To address this gap, we have developed PADIT-seq, a novel technology to detect TF-DNA interactions across the entire spectrum of affinities. By profiling the binding preferences of Egr1 and Hoxd13 to all possible 10-mers, we found that nucleotides flanking high-affinity binding sites create additional, overlapping lower-affinity sites that together modulate TF genomic occupancy. The formation of these extended recognition sequences is enabled by an inherent property of TF binding sites to interweave together. Highlighting the importance of lower-affinity binding sites, we provide mechanistic insights into their role in fine-tuning gene regulation.

2024-03-06 | GSE250601 | GEO

Comprehensive, high-resolution binding energy landscapes reveal context dependencies of transcription factor binding

Project description:Transcription factors (TFs) are primary regulators of gene expression in cells, where they bind specific genomic target sites to control transcription. Quantitative measurements of TF-DNA binding energies can improve the accuracy of predictions of TF occupancy and downstream gene expression in vivo and shed light on how transcriptional networks are rewired throughout evolution. Here, we present a novel sequencing-based TF binding assay and analysis pipeline (BET-seq, for Binding Energy Topography by sequencing) capable of providing quantitative estimates of binding energies for more than one million DNA sequences in parallel at high energetic resolution. Using this platform, we measured the binding energies associated with all possible combinations of 10 nucleotides flanking the known consensus DNA target for two model yeast TFs, Pho4 and Cbf1. A large fraction of these flanking mutations change overall binding energies by an amount equal to or greater than consensus site mutations, suggesting that current definitions of TF binding sites may be too restrictive. By systematically comparing estimates of binding energies output by deep neural networks (NN) and biophysical models trained on these data, we establish that dinucleotide specificities are sufficient to explain essentially all variance in observed binding behavior, with Cbf1 binding exhibiting significantly more non-additivity than Pho4. NN-derived binding energies agree with orthogonal biochemical measurements and reveal that dynamically occupied sites in vivo are both energetically and mutationally distant from the highest-affinity sites.

2018-03-17 | GSE111936 | GEO

Endogenous miRNA and target concentrations determine susceptibility to potential ceRNA competition, based on hierarchical binding affinities (iCLIP)

Project description:Target competition (ceRNA crosstalk) within miRNA-regulated gene networks has been proposed to influence biological systems. To assess target competition, we characterize and quantitate miRNA networks in two cell types. Argonaute iCLIP reveals that hierarchical binding of high to low affinity miRNA targets is a key characteristic of in vivo activity. Quantification of cellular miRNA and mRNA/ncRNA target pool levels indicates that miRNA-Target pool ratios and an affinity partitioned target pool accurately predict in vivo Ago binding profiles and miRNA susceptibility to target competition. Using single-cell reporters, we directly test predictions and estimate ~3,000 additional high affinity target sites can affect active miRNA families with low endogenous miRNA-Target ratios, such as miR-92/25. In contrast, the highly expressed miR-294 and let-7 families are not susceptible to increases of nearly 10,000 sites. These results show differential susceptibility based on endogenous miRNA-Target pool ratios and provide a physiological context for ceRNA competition in vivo.

2014-11-10 | GSE61347 | GEO

Endogenous miRNA and target concentrations determine susceptibility to potential ceRNA competition, based on hierarchical binding affinities (mRNA)

2014-11-10 | GSE61346 | GEO

Endogenous miRNA and target concentrations determine susceptibility to potential ceRNA competition, based on hierarchical binding affinities (small RNA)

2014-11-10 | GSE61345 | GEO

Quantitative modeling of transcription factor binding specificities using DNA shape

2015-03-01 | GSE60200 | GEO

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress

Combining transcription factor binding affinities with open chromatin data for accurate gene expression prediction

Project description:The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid cost and labour intensive TF ChIP-seq assays.It is important to develop reliable and fast computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices.TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq, using either peaks or footprints as input.In addition to open-chromatin data, also Histone-Marks (HMs) can be used in TEPIC to identify candidate TF binding sites.TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength.Using machine learning techniques, we show that incorporating low affinity binding sites improves our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites.Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance.In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq datasets.Finally, we show that these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively.

| EGAS00001002073 | EGA

Global profiling of protein-DNA and protein-nucleosome binding affinities using quantitative mass spectrometry

Project description:Interaction proteomics studies have provided fundamental insights into multimeric biomolecular assemblies and cell-scale molecular networks. Significant recent developments in mass spectrometry-based interaction proteomics have been fueled by rapid advances in label-free, isotopic, and isobaric quantitation workflows. Here, we report a quantitative protein-DNA and protein-nucleosome binding assay that uses affinity purifications from nuclear extracts coupled with isobaric chemical labeling and mass spectrometry to quantify apparent binding affinities proteome-wide. We use this assay with a variety of DNA and nucleosome baits to quantify apparent binding affinities of monomeric and multimeric transcription factors and chromatin remodeling complexes.

2018-05-02 | PXD007132 | Pride

MicroRNA 3'-compensatory pairing occurs through two binding modes, with affinity shaped by nucleotide identity and position [1]

Project description:MicroRNAs (miRNAs), in association with Argonaute (AGO) proteins, direct repression by pairing to sites within mRNAs. Compared to pairing preferences of the miRNA seed region (nucleotides 2–8), preferences of the miRNA 3′ region are poorly understood, due to the sparsity of measured affinities for the many pairing possibilities. We used RNA bind-n-seq with purified AGO2–miRNA complexes to measure relative affinities of >1,000 3′-pairing architectures for each miRNA. In some cases, optimal 3′ pairing increased affinity by >500-fold. Some miRNAs had two high-affinity 3′-pairing modes—one of which included additional nucleotides bridging seed and 3′ pairing to enable high-affinity pairing to miRNA nucleotide 11. The affinity of binding and the position of optimal pairing both tracked with the occurrence of G or oligo(G/C) nucleotides within the miRNA. These and other results advance understanding of miRNA targeting, providing insight into how optimal 3′ pairing is determined for each miRNA.

2022-03-31 | GSE174715 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data