Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

Quantitative modeling of transcription factor binding specificities using DNA shape


ABSTRACT: The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

ORGANISM(S): Homo sapiens

SUBMITTER: Namiko Abe 

PROVIDER: E-GEOD-60200 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

Similar Datasets

2021-01-05 | E-MTAB-9236 | biostudies-arrayexpress
2014-05-05 | E-GEOD-48660 | biostudies-arrayexpress
2015-01-21 | E-GEOD-65073 | biostudies-arrayexpress
2011-05-24 | E-GEOD-29460 | biostudies-arrayexpress
2023-01-04 | E-MTAB-11519 | biostudies-arrayexpress
2022-03-01 | E-MTAB-11484 | biostudies-arrayexpress
2014-06-06 | E-GEOD-58034 | biostudies-arrayexpress
2013-09-30 | E-GEOD-51156 | biostudies-arrayexpress
2015-03-01 | GSE60200 | GEO
2015-12-07 | E-GEOD-69796 | biostudies-arrayexpress