Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

15 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

ABSTRACT: To define the sequence preference of SALL4 C2H2 zinc finger domains, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified SALL4 ZFC1, ZFC2 and ZFC4 domains combined with no protein control experiment. We re-sequenced the libraries from E-MTAB-9236 with very high coverage to estimate the minimum number of reads required per sample for accurate results.

INSTRUMENT(S): NextSeq 500

ORGANISM(S): synthetic construct

SUBMITTER: Adrian Bird

PROVIDER: E-MTAB-11484 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

HT-SELEX of wild-type and mutated versions of recombinant DNA binding domain of SALL4

Project description:To investigate the differences in DNA binding specificity of wild-type SALL4 C2H2 zinc finger cluster 4 (ZFC4) and disease causing mutations in SALL4 ZFC4, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified wild-type SALL4 ZFC4 domain, mutated SALL4 ZFC4 (R900W) and mutated SALL4 ZFC4 (G921D) combined with no protein control experiment.

2023-01-04 | E-MTAB-11519 | biostudies-arrayexpress

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

Project description:To define the sequence preference of SALL4 C2H2 zinc finger domains, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified SALL4 ZFC1, ZFC2 and ZFC4 domains combined with no protein control experiment.

2021-01-05 | E-MTAB-9236 | biostudies-arrayexpress

ChIP-Seq of ES-E14 mouse embryonic stem cells investigating changes in Sall4

Project description:Sall4 is a stem cell factor which is important for embryogenesis. We have genetically modified Sall4 in mouse embryonic stem cells to access the preference of Sall4 binding site. There are three different genetic modifications for the ES cells in the form of Sall4 Knockout (KO), Sall4 Zinc Finger Cluster 4 Mutation (ZFC4mut) and Sall4 Zinc Finger Cluster 1-2 Deletion (ZFC1-2Δ) respectively that we have considered for our study.

2021-01-05 | E-MTAB-9197 | biostudies-arrayexpress

An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-M-NM-:B as an example

Project description:We provided an improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor. We valided the strategy by characterzing the DNA-binding specificty of NF-M-NM-:B p50 dimer. Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2014-05-05 | E-GEOD-48660 | biostudies-arrayexpress

Extensive characterization of NF-kappaB binding uncovers non-canonical motifs and advances the interpretation of genetic functional traits

Project description:We report the DNA binding preferences of 4 NF-kappaB dimers (p52p52, RELARELA, RELAp50, RELAp52) Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2011-05-24 | E-GEOD-29460 | biostudies-arrayexpress

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress

Timecourse RNA-seq of mouse embryonic stem cells during neural differentiation

Project description:Sall4 is a stem cell factor which is important for embryogenesis. We have genetically modified Sall4 in mouse embryonic stem cells to access the transcriptional changes. There are three different genetic modifications for the ES cells in the form of Sall4 Knockout (KO), Sall4 Zinc Finger Cluster 4 Mutation (ZFC4mut) and Sall4 Zinc Finger Cluster 1-2 Deletion (ZFC1-2Δ) respectively that we have considered for our study. Cells were subjected to neural differentiation and directly lysed on the plate at the appropriate timepoint and RNA was sequenced.

2021-01-05 | E-MTAB-9198 | biostudies-arrayexpress

Splicing enhances recruitment of methyltransferase HYPB/Setd2 and methylation of histone H3 lysine 36

Project description:Several lines of recent evidence support a role for chromatin in splicing regulation. Here we show that splicing can also contribute to histone modification, which implies a bidirectional communication between epigenetics and RNA processing. Genome-wide analysis of histone methylation in human cell lines and mouse primary T cells reveals that intron-containing genes are preferentially marked with H3K36me3 relative to intronless genes. In intron-containing genes, H3K36me3 marking is proportional to transcriptional activity, whereas in intronless genes H3K36me3 is always detected at much lower levels. Furthermore, splicing inhibition impairs recruitment of H3K36 methyltransferase HYPB/Setd2 and reduces H3K36me3, whereas splicing activation has the opposite effect. Moreover, the increase of H3K36me3 correlates with the length of the first intron, consistent with the view that splicing enhances H3 methylation. We propose that splicing is mechanistically coupled to recruitment of HYPB/Setd2 to elongating RNA Polymerase II. This experiment proposes to profile genome-wide binding profiles by ChIP-seq (Illumina, 36 bp tags) of RNA polymerase II (one biological replicate), the histone modification H3K36me3 (2 replicates) and a reference control input sample (genomic DNA after reverse cross-link, one replicate) in a human H1299 lung carcinoma cell line *** Raw data not provided for Samples GSM766322-GSM766324.

2011-07-25 | E-GEOD-30902 | biostudies-arrayexpress

RNA-Seq of mouse embryonic stem cells after knockout and re-introduction of Sall4a

Project description:Sall4 is a stem cell factor which is important for embryogenesis. In order to address transcriptional changes, we re-introduce Sall4 in homozygous Sall4 knockout (KO) mouse embryonic stem cells through random integration of Sall4 cDNA using a Piggybac vector which is Dox inducible. We also re-introduce EGFP in homozygous Sall4 knockout (KO) mouse embryonic stem cells and use it as a negative control.

2021-01-05 | E-MTAB-9202 | biostudies-arrayexpress

Project description:A small number of transcription factors, including Oct-3/4 and Sox2, constitute the transcriptional network that maintains pluripotency in embryonic stem (ES) cells. Previous reports suggested that some of these factors form a complex that binds the Oct-Sox element, a composite sequence consisting of closely juxtaposed Oct-3/4-binding and Sox2-binding sites. However, little is known regarding the components of the complex. In this study, we show that Sall4, a member of the Spalt-like family of proteins, directly interacts with Sox2 and Oct-3/4. Sall4 in combination with Sox2 or Oct-3/4 simultaneously occupies the Oct-Sox elements in mouse ES cells. Sall4 knockdown led to differentiation of ES cells. Overexpression of Sall4 in ES cells increased reporter activities in a luciferase assay when the Pou5f1- or Nanog-derived Oct-Sox element was included in the reporter. Microarray analyses revealed that Sall4 and Sox2 bound to the same genes in ES cells significantly more frequently than expected from random coincidence. These factors appeared to bind the promoter regions of a subset of the Sall4- and Sox2-double-positive genes in precisely similar distribution patterns along the promoter regions, suggesting that Sall4 and Sox2 associate with such Sall4/Sox2-overlapping genes as a complex. Importantly, gene ontology analyses indicated that the Sall4/Sox2-overlapping gene set is enriched for genes involved in maintaining pluripotency. Sall4/Sox2/Oct-3/4-triple-positive genes identified by referring to a previous study identifying Oct-3/4-bound genes in ES cells were further enriched for pluripotency genes than Sall4/Sox2-double-positive genes. These results demonstrate that Sall4 contributes to the transcriptional network operating in pluripotent cells, together with Oct-3/4 and Sox2. ChIP-on-chip experiments using anti-Sall4 or anti-Sox2 antibody were performed.

2012-12-28 | E-GEOD-40072 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data