Similar Datasets
Project description:T cells specific for alpha-myosin drive immunotherapy related myocarditis
| PRJNA880920 | ENA
Project description:Immune-related adverse events, particularly severe toxicities such as myocarditis, are major challenges to the utility of immune checkpoint inhibitors (ICIs) in anticancer therapy1. The pathogenesis of ICI-associated myocarditis (ICI-MC) is poorly understood. Pdcd1-/-Ctla4+/- mice recapitulate clinicopathological features of ICI-MC, including myocardial T cell infiltration2. Here, using single-cell RNA and T cell receptor (TCR) sequencing of cardiac immune infiltrates from Pdcd1-/-Ctla4+/- mice, we identify clonal effector CD8+ T cells as the dominant cell population. Treatment with anti-CD8-depleting, but not anti-CD4-depleting, antibodies improved the survival of Pdcd1-/-Ctla4+/- mice. Adoptive transfer of immune cells from mice with myocarditis induced fatal myocarditis in recipients, which required CD8+ T cells. The cardiac-specific protein α-myosin, which is absent from the thymus3,4, was identified as the cognate antigen source for three major histocompatibility complex class I-restricted TCRs derived from mice with fulminant myocarditis. Peripheral blood T cells from three patients with ICI-MC were expanded by α-myosin peptides. Moreover, these α-myosin-expanded T cells shared TCR clonotypes with diseased heart and skeletal muscle, which indicates that α-myosin may be a clinically important autoantigen in ICI-MC. These studies underscore the crucial role for cytotoxic CD8+ T cells, identify a candidate autoantigen in ICI-MC and yield new insights into the pathogenesis of ICI toxicity.
| S-EPMC9930174 | biostudies-literature
Project description:Ribonucleoprotein immunoprecipitation microarray (RIp-chip) study using various myosin proteins and myosin-specific chaperones from the fission Schizosaccaromyces pombe
2010-03-01 | E-TABM-335 | biostudies-arrayexpress
Project description:Ribonucleoprotein immunoprecipitation microarray (RIp-chip) study using various myosin proteins and myosin-specific chaperones from the fission Schizosaccaromyces pombe. Two strains were used. In rng3TAP the rng3 protein has been tagged with TAP to allow its detection and immunoprecipitation. The TAP strain expresses the TAP sequence alone (without being attached to an other protein)
2008-12-23 | E-TABM-516 | biostudies-arrayexpress
Project description:Pathological expansion of self-reactive T cells is a hallmark of autoimmune diseases. Notwith-standing, T cell autoreactivity can also benefit self-maintenance and foster tissue repair. Herein, we investigated whether heart-specific T cells exert salutary or detrimental effects in the context of the post myocardial infarction (MI) healing process in mice, and whether the findings can be translated to humans. Transferred cardiac-myosin-specific CD4+ T cells (TCR-M) selectively accumulate in the myocardium and mediastinal lymph nodes (med-LNs) of infarcted mice. TCR-M cells activated in the MI-context acquire a Foxp3+ regulatory phenotype, exhibit a distinct gene expression profile enriched with growth factors, and promote cardioprotection. Massive parallel sequencing of T cell receptors revealed that CD4+ T cells infiltrating the infarcted myo-cardium display a unique repertoire signature with skewed diversity and dominated by a limited set of expanded clones - hallmarks of antigen-specific responses. CD4+ Foxp3+ cells were also detected in myocardial biopsies obtained from patients who suffered MI, especially in associa-tion with the granulation tissue (i.e., healing phase). Noninvasive positron emission tomogra-phy/computed tomography (PET/CT) imaging using a CXCR4 radioligand revealed that MI pa-tients display enlarged med-LNs with increased T cellularity. Alterations in the med-LN corre-lated with infarct size and cardiac function. Taken together, these results provide strong evidence that the MI-context induces protective T cell autoimmunity in mice, and confirm the existence of an analogous physiological heart/med-LN/T cell axis in MI patients, which offers translational potential.
2019-08-14 | GSE116569 | GEO
Project description:Myosin IIa-deficient follicular B cells have a hyperactivated phenotype. To identify what pathways are regulated by myosin IIa, we performed RNA-seq of coding RNA on flow cytometry sorted follicular B cells from CD23Cre+Myh9fl/fl and CD23Cre+Myh9wt/fl mice.
2018-04-14 | GSE113114 | GEO
Project description:We performed a high-throughput, multiplexed quantitative proteomics analysis to determine protein abundance changes produced by BML-111 treatment in EAM and Ctrl mice. EAM was induced in 7 weeks-old BALB/c female mice by immunization at days 0 and 7 with a subcutaneous injection of 350 μg of murine cardiac myosin (MyHCα) in a 1:1 emulsion with complete Freund’s Adjuvant (SIGMA). MyHCα was isolated from hearts of Balb/c mice; control mice were injected with a 1:1 emulsion of physiological saline solution with complete Freund’s Adjuvant. Mice were treated daily for two weeks from day 7 by intraperitoneal injection with two complementary treatments: 1mg/Kg BML-111(Enzo Life Science) or its vehicle (2.5% ethanol). The proteomics analysis was performed in heart tissue protein extracts (four animals per group: Ctrl+Veh, EAM+Veh, Ctrl+BML and EAM+BML.
2022-12-07 | PXD024345 | Pride
Project description:Immune checkpoint inhibitors (ICIs) are effective against many cancers but can also cause immune-related adverse events. Although rare, ICI-mediated myocarditis has a high fatality rate of up to 40% and is also associated with heart failure and life-threatening arrhythmias. We characterized a population of CXCL9+CXCL10+ macrophages and CXCR3hi CD8+ T-cells in the hearts of mice with myocarditis and elucidated chemokine crosstalk between the CXCR3hi CD8+ effector T-cells and the CXCL9+CXCL10+ macrophages in the heart. Depletion of macrophages or blockade of CXCR3 both resulted in significantly decreased immune cell infiltration in the hearts of mice. Similarly, CXCR3 blockade decreased immune cell infiltration into the heart,, thus posing CXCR3 and its ligands as an attractive therapeutic target. Additionally, an in vitro transwell assay showed that selective blockade of CXCR3 and its ligand CXCL10 significantly decreased CD8+ T-cell migration towards macrophages, implicating this interaction in T-cell cardiotropism towards cardiac macrophages. These findings were compared with cardiac biopsies from patients with ICI myocarditis that also demonstrated infiltrating CXCR3+ lymphocytes and CXCL9+/CXCL10+ macrophages. In both mouse cardiac immune cells and patient peripheral blood immune cells, T-cell receptor (TCR)-sequencing revealed expanded TCRs that correlated with CXCR3hi CD8+ T-cells. The identification of a CXCR3-specific T-cell and macrophage interaction as important in the pathogenesis of ICI myocarditis offers a new potential target for a chemokine/chemokine receptor inhibition-focused form of therapy in this disease.
2025-01-31 | GSE250056 | GEO
Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.
2023-12-18 | GSE202685 | GEO
Project description:The insulin/IGF-IRS-PI3K-Akt pathway is highly conserved in evolution. To test whether this signaling cascade determines organ size in vertebrates, we have recently created mouse lines transgenic for constitutively active (caPI3K) and dominant-negative forms of PI3K (dnPI3K) (Shioi et al., 2000). Transgene expression is driven by the cardiac-specific a -myosin heavy chain (MHC) promoter. Both transgenic lines are characterized by moderate but highly consistent changes in heart size, despite the fact that body weight and the size of other organs are completely normal. caPI3K transgenic animals have hearts 20% larger than those of wild type littermates, whereas dnPI3K mice have hearts that are 17% smaller. The observed changes in heart size correlate with an appropriate increase or decrease in the size of transgenic cardiomyocytes. These hearts do not have cardiomyopathic changes, since the contractile function of transgenic hearts is normal, and signs of necrosis, apoptosis, or interstitial fibrosis are absent (see Physiology). These data suggest an autonomous role for PI3K in cell size regulation. Our goal is now to determine how activation of this system translates into changes in cell size by identifying the trigger and components of this signaling cascade. Heterozygous caPI3K (constitutively active PI3K) and dnPI3K (dominant-negative PI3K) transgenic female mice (5-14 months) compared with non-transgenic littermates. Transgene expression driven by the a -myosin heavy chain (a -MHC) promoter. Keywords: other
2003-07-24 | GSE558 | GEO