Transcriptomics

Dataset Information

0

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools


ABSTRACT: Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

ORGANISM(S): Mus musculus

PROVIDER: GSE202685 | GEO | 2023/12/18

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

| PRJNA836939 | ENA
2022-08-24 | GSE202684 | GEO
2011-02-17 | E-GEOD-27354 | biostudies-arrayexpress
2021-08-20 | PXD027822 | Pride
2019-08-20 | GSE136031 | GEO
2009-03-07 | E-GEOD-11259 | biostudies-arrayexpress
2022-07-29 | GSE181102 | GEO
| PRJNA836940 | ENA
2014-04-01 | E-GEOD-53444 | biostudies-arrayexpress
2012-02-15 | E-GEOD-35803 | biostudies-arrayexpress