Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Designing Molecular RNA Switches with Restricted Boltzmann Machines

ABSTRACT: Riboswitches are structured allosteric RNA molecules that change conformation in response to a metabolite binding event, eventually triggering a regulatory response. Computational modelling of the structure of these molecules is complicated by a complex network of tertiary contacts, stabilized by the presence of their cognate metabolite. In this work, we focus on the aptamer domain of SAM-I riboswitches and show that Restricted Boltzmann machines (RBM), an unsupervised machine learning architecture, can capture intricate sequence dependencies induced by secondary and tertiary structure, as well as a switching mechanism between open and closed conformations. The RBM model is then used for the design of artificial allosteric SAM-I aptamers. To experimentally validate the functionality of the designed sequences, we resort to chemical probing (SHAPE-MaP), and develop a tailored analysis pipeline adequate for high-throughput tests of diverse homologous sequences. We probed a total of 476 RBM designed sequences in two experiments, showing between 20% and 40% divergence from any natural sequence, obtaining ≈ 30% success rate of correctly structured aptamers that undergo a structural switch in response to SAM.

ORGANISM(S): synthetic construct Bacteria

PROVIDER: GSE266263 | GEO | 2024/05/06

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Genome-wide identification of natural RNA aptamers in prokaryotes and eukaryotes

Project description:RNAs are well-suited to act as cellular sensors that detect and respond to metabolite changes in the environment due to their ability to fold into complex structures. Here, we introduce a genome-wide strategy called PARCEL that experimentally identifies RNA aptamers in vitro, in a high-throughput manner. By applying PARCEL to a collection of prokaryotic and eukaryotic organisms, we have revealed 58 new RNA aptamers to three key metabolites, greatly expanding the list of natural RNA aptamers. The newly identified RNA aptamers exhibit significant sequence conservation, are highly structured and show an unexpected prevalence in coding regions. We identified a prokaryotic precursor tmRNA that acts as a vitamin B2 (FMN) binder to facilitate its maturation, as well as new coding-region eukaryotic riboswitches that bind and respond to FMN, highlighting FMN as a second class of eukaryotic riboswitches. PARCEL results show that RNA-based sensing and gene regulation is more widespread than previously appreciated in different organisms.

2018-03-06 | GSE106133 | GEO

Functional Validation of SAM Riboswitch Element A from Listeria monocytogenes

Project description:SreA is one of seven candidate S-adenosyl methionine (SAM) class I riboswitches identified in Listeria monocytogenes, a saprophyte and opportunistic foodborne pathogen. SAM is essential to all domains of life, serving as a ubiquitous methyl donor and mediator of trans-sulfuration. SreA precedes genes encoding a methionine ATP- binding cassette (ABC) transporter, which imports methionine, a sulfur containing amino acid and substrate for sulfur metabolism. SreA is presumed to regulate transcription of its downstream genes in a SAM-dependent manner. The proposed role of SreA in controlling the transcription of genes encoding an ABC transporter complex may have important implications for how the bacteria senses and responds to the availability of the metabolite SAM in the diverse environments in which L. monocytogenes persists. Here we validate SreA as a functional SAM-I riboswitch through ligand binding studies, structure characterization, and transcription termination assays. We determined that SreA has both a similar structure and SAM binding properties to other well characterized SAM-I riboswitches. However, SreA regulates transcription at a distinctly lower (nM) ligand concentration but does not substantially terminate transcription, even in the presence of mM SAM.

2025-05-05 | GSE266872 | GEO

Fingerprinting tertiary structure in complex RNAs using single-molecule correlated chemical probing

Project description:Single-molecule correlated chemical probing (smCCP) is an experimentally concise strategy for characterizing higher-order structural interactions in RNA. smCCP data yield rich, but complex, structural information on base pairing, conformational ensembles, and tertiary interactions. To date, through-space communication specifically measuring RNA tertiary structure has been difficult to isolate from structural communication reflective of other interactions. Here we introduce mutual information as a filtering metric to isolate tertiary structure communication contained within smCCP data and use this strategy to characterize the structural ensemble of the SAM-III riboswitch. We identified a smCCP fingerprint that is selective for states containing tertiary structure that forms concurrently with cognate ligand binding. We then successfully applied mutual information filters to independent RNAs and isolated through-space tertiary interactions in riboswitches and large RNAs with complex structures. smCCP, coupled with mutual information criteria, can now be used as a tertiary structure discovery tool, including to identify specific states in an ensemble that have higher-order structure. These studies pave the way for use of the straightforward smCCP experiment for discovery and characterization of tertiary structure motifs in complex RNAs.

2024-10-23 | GSE278422 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

CRISPR Display: A modular method for locus-specific targeting of long noncoding RNAs and synthetic RNA devices in vivo [RIP-Seq]

Project description:Noncoding RNAs (ncRNAs) comprise an important class of natural regulators that mediate a vast array of biological processes, including the modulation of chromatin architecture. Moreover, artificial ncRNAs have revealed that the functional capabilities of RNA are extremely broad. To further investigate and harness these capabilities, we developed CRISPR-Display ("CRISP-Disp"), a targeted localization strategy that uses Cas9 to deploy large RNA cargos to specific DNA loci. We demonstrate that exogenous RNA domains can be functionally appended onto the CRISPR scaffold at multiple insertion points, allowing the construction of Cas9 complexes with RNAs nearing one kilobase in length, with structured RNAs, protein-binding cassettes, artificial aptamers and pools of random sequences. CRISP-Disp also allows the simultaneous multiplexing of disparate functions at multiple targets. We anticipate that this technology will provide a powerful method with which to ectopically localize functional RNAs and ribonuceloprotein complexes at specified genomic loci. RNA Immunoprecipitation (RIP) against FLAG-tagged Cas9 protein, coexpressed with a large pool of CRISPR RNAs bearing random internal insertions

2015-05-11 | E-GEOD-62305 | biostudies-arrayexpress

Specific targeting of transcriptional T-box riboswitches leads to effective inhibition of S. aureus

Project description:T-box riboswitches belong to a specific class of RNA regulatory elements that control gene expression in Gram-positive bacteria, including prominent human pathogens. They sense the availability of amino acids by detecting the aminoacylation status of their cognate tRNAs and regulate the expression of genes involved in aminoacylation, amino acid transport, and metabolism. Recent advances on the structures and mechanisms of several regulatory non-coding RNAs among pathogenic bacteria have garnered attention for the development of a new generation of species-specific antibacterials. The frequently acquired resistance against current antibiotics has emerged as a significant challenge for healthcare systems and a serious threat to public health. Herein, we report the characterization of an effective T-box riboswitch inhibitor, termed T-box-i, which efficiently disrupts T-box riboswitch-mediated transcription in vivo. T-box-i was selected through a virtual screening campaign of commercially available small molecules against high-resolution crystallographic structures of T-box riboswitches. It exhibited no cytotoxicity in mammalian cells nor induced antibiotic resistance in S. aureus cultures. These findings provide valuable insights into exploiting T-box riboswitches as antibiotic targets and underscore the therapeutic potential of compounds that selectively target extensively structured regulatory RNA elements and interfaces to combat drug-resistant pathogens.

2025-10-19 | GSE300037 | GEO

CRISPR Display: A modular method for locus-specific targeting of long noncoding RNAs and synthetic RNA devices in vivo [RNA-Seq]

2015-05-11 | GSE66755 | GEO

CRISPR Display: A modular method for locus-specific targeting of long noncoding RNAs and synthetic RNA devices in vivo [RIP-Seq]

2015-05-11 | GSE62305 | GEO

Gene expression profiling of pancreatic epithelial cells in response to tissue contextual changes

Project description:To understand the molecular process associated with tissue morphogenesis of pancreatic epithelial cells, we profiled the transcriptomes of normal or malignant pancreatic organoids formed in three-dimenstional reconsitututed basement membrance (rBM). Cell monolayers cultured on rBM-coated culture plastics were used as controls. HPDE (immortalized pancreatic epithelial cells) and PANC-1 cells (pancreatic cancer cells) were seeded on reconstituted basement membrane (rBM)-coated culture plastics or cultured on top of three-dimensional (3D) rBM gels. Total RNA samples were collected from cell monolayers or 3D cell clusters (formed at day 2), pancreatic tubules or tumor spheroids (formed at day 6) in the rBM culture, followed by global gene expression profiling.

2012-11-15 | E-GEOD-42270 | biostudies-arrayexpress

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data