Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Genome-wide identification of natural RNA aptamers in prokaryotes and eukaryotes

ABSTRACT: RNAs are well-suited to act as cellular sensors that detect and respond to metabolite changes in the environment due to their ability to fold into complex structures. Here, we introduce a genome-wide strategy called PARCEL that experimentally identifies RNA aptamers in vitro, in a high-throughput manner. By applying PARCEL to a collection of prokaryotic and eukaryotic organisms, we have revealed 58 new RNA aptamers to three key metabolites, greatly expanding the list of natural RNA aptamers. The newly identified RNA aptamers exhibit significant sequence conservation, are highly structured and show an unexpected prevalence in coding regions. We identified a prokaryotic precursor tmRNA that acts as a vitamin B2 (FMN) binder to facilitate its maturation, as well as new coding-region eukaryotic riboswitches that bind and respond to FMN, highlighting FMN as a second class of eukaryotic riboswitches. PARCEL results show that RNA-based sensing and gene regulation is more widespread than previously appreciated in different organisms.

ORGANISM(S): Pseudomonas aeruginosa Bacillus subtilis Candida albicans

PROVIDER: GSE106133 | GEO | 2018/03/06

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Facile Discovery of Cell-surface Protein Targets of Cancer Cell Aptamers

Project description:Cancer biomarker discovery constitutes a frontier in cancer research. In recent years, cell-binding aptamers have become useful molecular probes for biomarker discovery. However, there are few successful examples, and the critical barrier resides in the identification of the cell-surface protein targets for the aptamers, where only a limited number of aptamer targets have been identified so far. Herein, we developed a universal SILAC-based quantitative proteomic method for target discovery of cell-binding aptamers. The method allowed for distinguishing specific aptamer-binding proteins from non-specific proteins based on abundance ratios of proteins bound to aptamer-carrying bait and control bait. In addition, we employed fluorescently labeled aptamers for monitoring and optimizing the binding conditions. We were able to identify and validate selectin L and integrin 4 as the protein targets for two previously reported aptamers, Sgc-3b and Sgc-4e, respectively. This strategy should be generally applicable for the discovery of protein targets for other cell-binding aptamers, which will promote the applications of these aptamers.

2022-02-28 | PXD002480 | Pride

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

Designing Molecular RNA Switches with Restricted Boltzmann Machines

Project description:Riboswitches are structured allosteric RNA molecules that change conformation in response to a metabolite binding event, eventually triggering a regulatory response. Computational modelling of the structure of these molecules is complicated by a complex network of tertiary contacts, stabilized by the presence of their cognate metabolite. In this work, we focus on the aptamer domain of SAM-I riboswitches and show that Restricted Boltzmann machines (RBM), an unsupervised machine learning architecture, can capture intricate sequence dependencies induced by secondary and tertiary structure, as well as a switching mechanism between open and closed conformations. The RBM model is then used for the design of artificial allosteric SAM-I aptamers. To experimentally validate the functionality of the designed sequences, we resort to chemical probing (SHAPE-MaP), and develop a tailored analysis pipeline adequate for high-throughput tests of diverse homologous sequences. We probed a total of 476 RBM designed sequences in two experiments, showing between 20% and 40% divergence from any natural sequence, obtaining ≈ 30% success rate of correctly structured aptamers that undergo a structural switch in response to SAM.

2024-05-06 | GSE266263 | GEO

Potential capacity of aptamers to trigger immune activation in human blood

Project description:Target specific short single-stranded DNA (ssDNA) molecules, called aptamers, are auspicious ligands for numerous in vivo applications. However, aptamers are synthetic molecules, which might be recognized by the immune cells in vivo and induce an activation of the innate immune system. Thus, immune activation potential of synthetic ssDNA oligonucleotides (ODNs) was determined using a well established closed-loop circulation model. Fresh human blood was incubated at 37Â°C for 2 or 4 hours with ssDNA ODNs (SB_ODN) or CpG ODN as positive control. Transcriptional changes were determined by microarray analyses. Blood samples containing SB_ODN demonstrated after 4 hours a significant regulation of 295 transcripts. Amongst others, CCL8, CXCL10, CCL7 and CXCL11 were highest regulated genes. Gene Ontology terms and KEGG pathway analyses exhibited that the differentially expressed genes belong to the transcripts that are regulated during an immune and inflammatory response, and were overrepresented in TLR signaling pathway. This study shows for the first time the potential of aptamers to activate immune system after systemic application into the human blood. Thus, we highly recommend performing of these preclinical tests with potential aptamer-based therapeutics. To evaluate the influence of synthetic ssDNA oligonucleotides (SB_ODN, CpG_ODN) on the cells of circulating peripheral blood (n=3), the samples were divided into 7 groups, 0h_without ssDNA, 2h_without ssDNA, 2h_with SB_ODN, 2h_with CpG_ODN, 4h_without ssDNA, 4h_with SB_ODN, 4h_with CpG_ODN. Baseline value samples (0h_without ssDNA) were obtained after blood collection without rotating in the closed-loop model. Negative control samples (2h_without ssDNA and 4h_without ssDNA) did not include oligonucleotides but rotated in the closed-loop model.

2013-05-07 | E-GEOD-46676 | biostudies-arrayexpress

Skeletal muscle-targeted RNA aptamers

Project description:Selection and identification of skeletal muscle-targeted RNA aptamers for therapeutic oligonucleotide delivery.

| PRJEB23653 | ENA

Potential capacity of aptamers to trigger immune activation in human blood

Project description:Target specific short single-stranded DNA (ssDNA) molecules, called aptamers, are auspicious ligands for numerous in vivo applications. However, aptamers are synthetic molecules, which might be recognized by the immune cells in vivo and induce an activation of the innate immune system. Thus, immune activation potential of synthetic ssDNA oligonucleotides (ODNs) was determined using a well established closed-loop circulation model. Fresh human blood was incubated at 37°C for 2 or 4 hours with ssDNA ODNs (SB_ODN) or CpG ODN as positive control. Transcriptional changes were determined by microarray analyses. Blood samples containing SB_ODN demonstrated after 4 hours a significant regulation of 295 transcripts. Amongst others, CCL8, CXCL10, CCL7 and CXCL11 were highest regulated genes. Gene Ontology terms and KEGG pathway analyses exhibited that the differentially expressed genes belong to the transcripts that are regulated during an immune and inflammatory response, and were overrepresented in TLR signaling pathway. This study shows for the first time the potential of aptamers to activate immune system after systemic application into the human blood. Thus, we highly recommend performing of these preclinical tests with potential aptamer-based therapeutics.

2013-05-07 | GSE46676 | GEO

RNA aptamers specific for IL4-treated MSC2 cell line

Project description:RNA aptamers specific for IL4-treated MSC2 cell line

| PRJNA450989 | ENA

Natural RNA polymerase aptamers regulate transcription in E. coli

Project description:Natural RNA polymerase aptamers regulate transcription in E. coli

| PRJNA385824 | ENA

Blocker-SELEX: A Structure-Guided Strategy for Developing Inhibitory Aptamers Disrupting Transcription Factor Interactions

Project description:Despite the well-established significance of transcription factors (TFs) in pathogenesis, their utilization as pharmacological targets has been limited by the inherent challenges mainly associated with modulating their protein-protein and protein-DNA interactions. The lack of defined small-molecule binding pockets and the nuclear localization of TFs makes neither small molecule inhibitors nor neutral antibodies suitable in blocking TF interactions. Aptamers are short oligonucleotides exhibiting high affinity and specificity for a diverse range of targets. The large molecular weights, expansive blocking surfaces and efficient cellular internalization make aptamers as a compelling molecular tool for traditional TF interaction modulators. Here, we report a structure-guided design strategy called Blocker-SELEX for developing inhibitory aptamers (iAptamer) that selectively block TF interactions. Our approach led to the discovery of an iAptamer that cooperatively disrupts SCAF4/SCAF8-RNA Polymerase II (RNAP2) interactions, thus dysregulates RNAP2 dependent gene expression and splicing, leading to the impairing of cell proliferation. This approach was further applied to develop iAptamers efficiently block WDR5-MYC interaction. Together, our study highlights the potential of Blocker-SELEX in developing iAptamers that effectively disrupt TF interactions, and the generated iAptamers hold promising implications as chemical tools in studying biological functions of TF interactions and the potential for nucleic acids drug development.

2024-02-01 | GSE254651 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data