Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Cyclosporine A Enhances the Efficacy of Venetoclax Against FLT3-ITD AML via the PI3K/AKT/mTOR Signaling Pathway

ABSTRACT: Acute myeloid leukemia (AML) with the Fms-like tyrosine kinase 3 internal tandem duplication (FLT3-ITD) mutation accounts for approximately 25-30% of cases and is associated with a poor prognosis, characterized by high relapse rates and significantly reduced overall survival. The use of single-agent venetoclax in FLT3-ITD AML has shown limited efficacy, with drug resistance frequently emerging. In this study, we demonstrate that cyclosporine A (CsA) sensitizes FLT3-ITD AML cells to venetoclax by inhibiting cell proliferation, promoting apoptosis, and disrupting mitochondrial function. Mechanistically, CsA enhances the anti-AML effects of venetoclax by inhibiting NFATC1 through the PI3K/AKT/mTOR signaling pathway. These findings offer promising new therapeutic strategies for managing refractory and relapsed AML, providing a basis for future combination therapies targeting FLT3-ITD mutations.

ORGANISM(S): Homo sapiens

PROVIDER: GSE282105 | GEO | 2025/06/06

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Phosphoproteome Analysis Reveals Differential Mode of Action of Sorafenib in Wildtype and Mutated FLT3 AML Cells

Project description:Constitutively activating internal tandem duplication (ITD) alterations of the receptor tyrosine kinase FLT3 (Fms-like tyrosine kinase 3) are common in acute myeloid leukemia (AML) and classifies FLT3 as an attractive therapeutic target. So far, application of FLT3 small molecule inhibitors such as Sorafenib has resulted only in partial and transient clinical responses in FLT3-ITD+ patients. Only recently, a prolonged event-free survival has been observed in AML patients who were treated with Sorafenib in addition to standard therapy. Here, we studied the Sorafenib effect on proliferation in a panel of 13 FLT3-ITD- and FLT3-ITD+ AML cell lines. Sorafenib IC50 values ranged from 0.001 to 5.6 µM, whereas FLT3-ITD+ cells (MOLM-13, MV4;11) were found more sensitive to Sorafenib than FLT3-ITD- cells. However, we identified two FLT3-ITD- cell lines (MONO-MAC-1 and OCI-AML-2) which were also Sorafenib sensitive. Phosphoproteome analyses revealed that the affected pathways differed in Sorafenib sensitive FLT3-ITD- and FLT3-ITD+ cells. In MV4;11 cells Sorafenib suppressed mTOR signalling by inhibiting direct inhibition of FLT3. In MONO-MAC-1 cells Sorafenib inhibited the MEK/ERK pathway by inhibition of the RET tyrosine kinase. These data suggest that the FLT3 status in AML patients might not be the only predictive factor for a response to Sorafenib.

2017-05-02 | PXD004442 | Pride

Cyclosporine A Enhances the Efficacy of Venetoclax Against FLT3-ITD AML via the PI3K/AKT/mTOR Signaling Pathway

Project description:Cyclosporine A Enhances the Efficacy of Venetoclax Against FLT3-ITD AML via the PI3K/AKT/mTOR Signaling Pathway

| PRJNA1187208 | ENA

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

2014-01-15 | GSE54065 | GEO

Genetic and Phenotypic correlates of clinical outcomes with Venetoclax in Acute Myeloid Leukemia: The GEN-PHEN-VEN study

Project description:Resistance to venetoclax-based therapy in acute myeloid leukemia (AML) includes genetic (i.e., mutations in N/KRAS, FLT3-ITD, TP53) and phenotypic (i.e., monocytic differentiation) features. Whether monocytic differentiation contributes to clinical venetoclax resistance secondary to a genetic bias remains unknown. This multimodal, multicenter, international analysis inclusive of 678 patients comprehensively characterized the prognostic role of monocytic differentiation in AML patients treated with hypomethylating agents combined with venetoclax. AML genetics and monocytic differentiation (HR: 1.89, 95% CI: 1.35-2.66, p < 0.001) in NPM1 wild-type cases correlated with an increased risk of death. Clustering of centralized quantitative multiparameter flow cytometry data, evaluation of RNA sequencing-derived AML maturation stage, and single-cell proteogenomics linked driver mutations with AML phenotype and anti-apoptotic gene expression. This comprehensive analysis of AML genetics, phenotype, and anti-apoptotic protein expression highlights the complementary role these factors impart following venetoclax-based therapy.

2025-05-14 | GSE296535 | GEO

FLT3 inhibition upregulates HDAC8 via FOXO to inactivate p53 and promote maintenance of FLT3-ITD+ acute myeloid leukemia

Project description:Internal tandem duplication (ITD) mutations within the FMS-like receptor tyrosine kinase-3 (FLT3) can be found in up to 25~30% of acute myeloid leukemia (AML) patients and confer a poor prognosis. Although FLT3 tyrosine kinase inhibitors (TKIs) have shown clinical responses, the overall outcome of FLT3-ITD+ AML patients remains poor, and most of them would relapse very shortly. TKIs can not eliminate primitive FLT3-ITD+ AML cells, which are potential sources of relapse. Therefore, elucidating the mechanisms underlying FLT3-ITD+ AML maintenance and drug resistance is essential to develop novel, effective treatment strategies. Here, we demonstrate that FLT3 inhibition induces histone deacetylase 8 (HDAC8) upregulation through FOXO1 and FOXO3-mediated transactivation in FLT3-ITD+ AML cells. Upregulated HDAC8 deacetylates and inactivates p53, leading to leukemia maintenance and drug resistance upon TKIs treatment. Genetic or pharmacological inhibition of HDAC8 re-activates p53, abrogates leukemia maintenance and significantly enhances TKI-mediated elimination of FLT3-ITD+ AML cells. Importantly, in FLT3-ITD+ AML patient-derived xenograft models, the combination of FLT3 TKI (AC220) with a HDAC8 inhibitor (22d) significantly inhibits leukemia progression and effectively reduces primitive FLT3-ITD+ AML cells. Moreover, we extend these findings to an AML subtype harboring another tyrosine kinase activating mutation. In conclusion, our study demonstrates that HDAC8 upregulation as an important mechanism to resist TKIs and promote leukemia maintenance, and suggests that combining HDAC8 inhibition with TKI treatment could be a promising strategy to treat FLT3-ITD+ AML and other tyrosine kinase mutation-harboring leukemias.

2020-02-13 | GSE138057 | GEO

Phosphoproteomic characterization of primary AML samples and relevance for response towards FLT3-inhibitors

Project description:Kinase hyperactivity is a common driver of acute myeloid leukemia (AML) and serves as a therapeutic target. The most frequent genetic aberration leading to hyperactive kinase signaling and poor prognosis is internal tandem duplication (ITD) of the FMS-tyrosine-like Kinase 3-gene (FLT3). FLT3-ITD induces ligand independent activation of FLT3 and downstream pathways leading to proliferation, decreased apoptosis and partial differentiation block. Combined with chemotherapy, FLT3-Tyrosine Kinase Inhibitor (FLT3-TKI) midostaurin improves overall survival (OS) of newly diagnosed FLT3-mutated AML patients, whereas single agent gilteritinib proved superior to chemotherapy in relapsed/refractory FLT3-mutated AML patients . As the primary targets of currently approved FLT3-TKIs are tyrosine (Y) kinases, we hypothesized that direct evaluation of tyrosine phosphorylation status could reveal pY phosphorylation profiles associated with FLT3-TKI response. Therefore, we used label-free pTyr-based phosphoproteomics in 35 primary AML samples (18 FLT3-WT, 17 FLT3-ITD), to identify differentially phosphorylated proteins underlying response to the FLT3-TKIs gilteritinib and midostaurin. We identified a total of 3024 unique phosphosites (median 1299 per sample, range 286 – 1612, pS:pT:pY 11.9%:9.5%:78.6%). Due to low number of identified phosphosites, we excluded two samples from further analyses. On the remaining 33 samples, we additionally performed IMAC global phosphoproteomics and on 17 samples protein expression analysis.

2021-09-10 | PXD024235 | Pride

Mitoxantrone-liposome sensitizes Flt3-ITD acute myeloid leukemia to gilteritinib treatment

Project description:FMS-like tyrosine kinase 3 (FLT3) is the most frequently mutated gene in acute myeloid leukemia (AML), and is associated with a poor prognosis and high relapse rate. Gilteritinib, as a second-generation FLT3 inhibitor, is an important target drug in the treatment of FLT3-ITD AML patients, but it still faces the problems of drug resistance and reduced potency. In this study, we found that mitoxantrone-liposome can sensensitized gilteritinib and enhanced the therapeutic effect in vivo and in vitro. RNA-sequencing revealed that the combination treatment resulted in specific changes in gene expression, reduced drug resistance and the mechanism. Primary AML cells harvested from patients with FLT3-ITD AML showed a significant response to combination treatment in vitro. Our data suggest represents a novel and promising therapeutic strategy for FLT3-ITD AML patients and relapsed/refractory(R/R) AML.

2025-03-19 | GSE276384 | GEO

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

Microenvironmental CXCL12 Deletion Enhances Flt3-ITD Acute Myeloid Leukemia Stem Cell Response to Therapy by Reducing p38 MAPK Signaling

Project description:Fms-like tyrosine kinase 3 (Flt3) tyrosine kinase inhibitors (Flt3-TKI) have improved outcomes for patients with Flt3-mutated acute myeloid leukemia (AML) but are limited by resistance and relapse, suggesting persistence of leukemia stem cells (LSC). Here we utilized a Flt3-internal tandem duplication (Flt3-ITD) and Tet2-deleted AML genetic mouse model to characterize Flt3-ITD AML LSC and their resistance to Flt3-TKI. We show that LSC were enriched within the primitive ST-HSC population. CXCl12-expressing osteoprogenitors were increased in the Flt3-ITD AML marrow and FLT3-ITD LSC showed increased expression of the CXCL12 receptor CXCR4. CXCL12 deletion from the microenvironment enhanced AML targeting by combined Flt3-TKI and chemotherapy treatment with enhanced LSC targeting. We found that both treatment and CXCL12 deletion partially reduced p38 mitogen-activated protein kinase (p38) signaling with increased, but not complete, reduction seen with combined treatment and CXCL12 deletion. Our studies suggest that p38 contributes to CXCL12-mediated maintenance of AML LSC following Flt3-TKI and chemotherapy treatment, but that p38 inhibition enhances AML LSC response to treatment to a greater extent than CXCL12 deletion alone. This study supports a role for p38 signaling in CXCL12-mediated protection of AML LSC from treatment and provide a rationale for targeting p38 signaling to enhance Flt3-ITD AML targeting.

2024-01-03 | GSE212428 | GEO

FLT3 gene-expression signature in normal karyotype AML

Project description:Acute myeloid leukemia with normal karyotype (NK-AML) represents a cytogenetic grouping with intermediate prognosis but substantial molecular and clinical heterogeneity. Within this subgroup, presence of FLT3 (FMS-like tyrosine kinase 3) internal tandem duplication (ITD) mutation predicts less favorable outcome. The goal of our study was to discover gene-expression patterns correlated with FLT3-ITD mutation, and to evaluate the utility of a FLT3 signature for prognostication. The dataset comprises gene-expression profiles of 137 normal karyotype acute myeloid leukemia (NK-AML) specimens carried out using Stanford cDNA microarrays, to accompany the study of L Bullinger et al. For each array, Channel 2 represents Cy5-labeled NK-AML RNA, and Channel 1 Cy3-labeled universal reference RNA. Keywords: Logical Set DNA microarrays were used to profile gene expression in a training set of 65 NK-AML cases. Supervised analysis was applied to build a gene expression-based predictor of FLT3-ITD mutation status. The predictor was then evaluated by classifying expression profiles from an independent test set of 72 NK-AML cases.

2008-02-27 | E-GEOD-8043 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data