Dataset Information

Characterization of gRNA-Dependent and gRNA-Independent Off-Target Binding Sites of PspCas13b and RfxCas13d in Mammalian Cells [RNA-Seq]

ABSTRACT: CRISPR-Cas13 systems, harnessed for RNA-guided transcriptome editing, hold significant promise for clinical and in vivo therapeutic applications. However, understanding their in vivo target specificity and recognition rules remains a challenge. In this study, we employed the uSpyCLIP method, which enhances sensitivity and specificity for identifying RNA-binding protein (RBP) binding sites, to map the transcriptome-wide binding sites of catalytically inactive PspCas13b (dPspCas13b) and RfxCas13d (dRfxCas13d) in HEK293T cells, using a variety of single guide RNAs (gRNAs). Surprisingly, we identified both gRNA-dependent and gRNA-independent off-target binding sites for both dCas13 complexes. These off-target sites exhibited distinct RNA structural and sequence signatures: dPspCas13b's gRNA-independent binding was associated with specific RNA structural features, while dRfxCas13d's was linked to unique sequence motifs. Analysis of gRNA-dependent off-target sites revealed the crucial role of the DR-distal and middle regions of the gRNA in determining binding specificity. mRNA sequencing and biochemical assays further indicated that while off-target binding does not directly affect mRNA levels, it can perturb the expression of certain endogenous proteins. Therefore, our findings provide important insights into the characteristics of gRNA-dependent and gRNA-independent off-target binding for PspCas13b and RfxCas13d, offering valuable guidance for optimizing Cas13 and gRNA design in future applications.

ORGANISM(S): Homo sapiens

PROVIDER: GSE291437 | GEO | 2026/01/27

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other
	GSE291437_merged_raw_counts2.txt.gz	Txt
	GSE291437_raw_counts.txt.gz	Txt

Items per page:

1 - 3 of 3

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Characterization of gRNA-Dependent and gRNA-Independent Off-Target Binding Sites of PspCas13b and RfxCas13d in Mammalian Cells [RNA-Seq]

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets