Dataset Information

Exapted CRISPR-Cas12f homologs drive RNA-guided transcription

ABSTRACT: Bacterial transcription initiation is a tightly regulated process that canonically relies on sequence-specific promoter recognition by dedicated sigma (σ) factors, leading to functional DNA engagement by RNA polymerase (RNAP). Although the seven σ factors in E. coli have been extensively characterized, Bacteroidetes species encode dozens of specialized, extracytoplasmic function σ factors (σE) whose precise roles are unknown, pointing to additional layers of regulatory potential. Here we uncover an unprecedented mechanism of RNA-guided gene activation involving the coordinated action of σE factor in complex with nuclease-dead Cas12f (dCas12f). We screened a large set of genetically-linked dCas12f and σE homologs in E. coli using RIP-seq and ChIP-seq experiments, revealing systems that exhibited robust guide RNA enrichment and DNA target binding with a minimal 5ʹ-G target-adjacent motif (TAM). Recruitment of σE was dependent on dCas12f and guide RNA (gRNA), suggesting direct protein-protein interactions, and co-expression experiments demonstrated that the dCas12f-gRNA-σE ternary complex was competent for programmable recruitment of the RNAP holoenzyme. Remarkably, dCas12f-RNA-σE complexes drove potent gene expression in the absence of any requisite promoter motifs, with de novo transcription start sites defined exclusively by the relative distance from the dCas12f-mediated R-loop. Our findings highlight a new paradigm of RNA-guided transcription (RGT) that embodies natural features reminiscent of CRISPRa technology developed by humans.

ORGANISM(S): Flagellimonas taeanensis Escherichia coli

PROVIDER: GSE293889 | GEO | 2025/07/30

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:When performed at single bp resolution, the genome-wide location, occupancy level, and structural organization of DNA binding proteins provides mechanistic insights into genome regulation. Here we use ChIP-exo to provide the first high resolution view of the epigenomic organization of the E. coli transcription machinery and nucleoid structural proteins when cells are growing exponentially and upon rapid reprogramming (acute heat shock). We suggest that indirect readout of DNA shape at the flanks of cognate motifs provide major contributions to site specificity at promoter positions -35/-24 and -10/-12. We examined the site specificity of three sigma factors (RpoD/70, RpoH/32, and RpoN/54), RNA polymerase (RNAP or RpoA, B, C) and two nucleoid proteins (Fis and IHF). Our results confirm and refine reports that RpoD binds most annotated promoters, whereas RpoH and RpoN bind a much smaller subset, each through their cognate motifs. However, only upon heat shock does RpoH becomes active for RNAP recruitment. In contrast, upon heat shock RpoD remains active at its cognate promoters (including at heat shock genes), whereas RpoN remains inactive at its cognate promoters. RpoN binds ~1,000 non-annotated RpoN motifs, which may reflect a large number of condition-specific transcription units. Occupancy patterns of sigma factors and RNAP suggest a common promoter recruitment mechanism that differs from the long-standing views that sigma and RNAP are co-recruited as a complex, and also simultaneously dissociate from promoters. Our findings suggest that sigma factors are recruited and/or maintained at most promoters via an RNAP-independent mechanism. When RNAP arrives, it dwells for a relatively short time before clearing the promoter, leaving sigma behind. Taken together these findings add new dimensions to how sigma factors achieve promoter specificity through DNA sequence and shape and redefine mechanistic steps in regulated promoter assembly in E. coli.

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Exapted CRISPR-Cas12f homologs drive RNA-guided transcription

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets