Dataset Information

Dissecting the cell-type specific role of a dominant resistance gene during viral infection [scRNA-Seq]

ABSTRACT: Plant viruses cause widespread crop epidemics, with resistance (R) genes playing key roles in plant defense by triggering responses that limit viral replication and spread. However, given the diversity of plant cell types and their developmental paths, the specific roles of R genes in distinct cell types remain unclear. Using tomato brown rugose fruit virus (ToBRFV), which partially overcomes the tobamovirus resistance gene Tm-22, this study employed single-cell RNA sequencing to explore infection dynamics and Tm-22-mediated responses at the cellular level. Results indicated that upon ToBRFV infection, the Tm-22 gene and the tm-2 allele, which carries a recessive form of Tm-22, differentially regulate the composition of cell types in tomato leaves. Tm-22 does not fully inhibit viral entry or movement during the early stages but selectively restricts viral replication or accumulation in certain cell types. ToBRFV differentially modulates signaling pathways depending on cell type and genotype, including Tm-22 and tm-2 homozygotes. Pseudotime analysis revealed that during mesophyll cell development in Tm-22 plants, ToBRFV reverses expression of BR positive regulators, but not negative ones; silencing these BR positive regulators increased infection in Tm-22 plants while suppressing it in tm-2 plants, linking BR signaling to Tm-22-dependent resistance. This study offers the first cell-type-specific insight into R gene function, showing how Tm-22 restrains ToBRFV accumulation through BR signaling pathways. It provides a valuable framework for future single-cell investigations of resistance genes, enhancing our understanding of plant-virus interactions.

ORGANISM(S): Solanum lycopersicum

PROVIDER: GSE300843 | GEO | 2026/04/09

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Plant and virus materials, inoculation and symptom evaluation Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA). Microarray sample preparation and determination of viral titers Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).

Project description:The plant response may be triggered by various factors, including pathogens, non-pathogenic microbes, and natural or synthetic molecules, such as salicylic acid (SA), benzo(1,2,3)-Thiadiazole-7-Carbothioic Acid S-Methyl Ester (BTH) that are considered as plant resistance inducers. Resistance inducers mobilize the plant for the synthesis of defense compounds, but they are not directly toxic for the plant. The BTH is an analogue of SA, a molecule naturally synthesized in the plant during systemic acquired resistance (SAR). In this study, we hypothesized that challenging the plant with resistance inducer causes an increase in the level of proteins associated with defence response to external stimuli with primary metabolism and that the action of the choline derivative of the BTH (in the form of the ionic liquid) during induction of resistance in tomato plants is mediated by to some extent similar signaling pathways as it is in the case of unmodified BTH compound. Therefore, this study aimed to identify global proteome changes occurring in tomato plants exposed to resistance inducers as well as to identify common pathways associated with the plant's defense response to (+)ssRNA viruses induced upon both, viral infection and prior resistance inducer treatment. The effect of ionic liquids on changes in plant proteome is not described in the literature. The ionic character of compounds offers a great advantage of using them as the plant resistance inducer. The high chemical and thermal stability, as well as low volatility, guarantees safe application in fields. For that reason, comparing the action of the resistance inducer in the form of an ionic liquid with the core compound (BTH) will help to elucidate the mode of action of ionic liquid derivatives in plant resistance induction. To this end, two RNA-type viruses from different families were tested: tomato mosaic virus (ToMV, Virgaviridae) and potato virus Y (PVY, Potyviridae). The most affected processes presented in the results were: photosynthesis, regulation of oxidative stress, metabolism of glutathione and chitin, cell wall reorganization. The increased impact on the regulation of primary metabolism in inducer-treated plants (both for BTH and cholinium ionic liquid derivative). The response to ToMV and PVY was more intense when infected plants were pre-treated with inducers. The increased abundances of defense priming proteins with changes in cell wall organization may block virus transport from infected spots to other tissue of the host plant so that the losses caused by the disease will be lower.

Project description:BACKGROUND: The tomato psyllid, Bactericera cockerelli Šulc (Hemiptera: Triozidae), is a pest of solanaceous crops such as tomato (Solanum lycopersicum L.) in the U.S. and vectors the disease-causing pathogen ‘Candidatus Liberibacter solanacearum’. Currently, the only effective strategies for controlling the diseases associated with this pathogen involve regular pesticide applications to manage psyllid population density. However, such practices are unsustainable and will eventually lead to widespread pesticide resistance in psyllids. Therefore, new control strategies must be developed to increase host-plant resistance to insect vectors. For example, expression of constitutive and inducible plant defenses can be improved through selection. Currently, it is still unknown whether psyllid infestation has any lasting consequences on tomato plant defense or tomato plant gene expression in general. RESULTS: To characterize the genes putatively involved in tomato defense against psyllid infestation, RNA was extracted from psyllid-infested and uninfested tomato leaves (Moneymaker) three weeks post-infestation. Transcriptome analysis identified 362 differentially expressed genes. These differentially expressed genes were primarily associated with defense responses to abiotic/biotic stress, transcription/translation, cellular signaling/transport, and photosynthesis. These gene expression changes suggested that tomato plants underwent a reduction in plant growth/health in exchange for improved defense against stress that was observable three weeks after psyllid infestation. Consistent with these observations, tomato plant growth experiments determined that the plants were shorter three weeks after psyllid infestation. Furthermore, psyllid nymphs had lower survival rates on tomato plants that had been previously psyllid infested. CONCLUSION: These results suggested that psyllid infestation has lasting consequences for tomato gene expression, defense, and growth.

Dataset Information

Dissecting the cell-type specific role of a dominant resistance gene during viral infection [scRNA-Seq]

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets