Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Effect of HIF-1alpha knockout in gene expression profile of osteosarcoma cells in vivo.

ABSTRACT: To explore in vivo changes in gene expression of osteosarcoma cells upon depletion of HIF-1alpha we performed RNAseq analysis using Mock control AXT cells and HIF-1alpha KO AXT cells. HIF1alpha was knocked out using CRISPR-Cas9 with two different target sequences. KO1-1 and KO1-2 cells are derived from target sequence#1:5’- AGATGTGAGCTCACATTGTGGGG -3’ (exon3) and KO2 cells are from #2:5’-GCTAACAGATGACGGCGACATGG-3’ (exon5). AXT cells were established from BMSCs of Ink4a/Arf null mouse by overexpressing human c-MYC (Shimizu T, et al. Oncogene, 2010).

ORGANISM(S): Mus musculus

PROVIDER: GSE307480 | GEO | 2026/01/04

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

HIF-1alpha and HIF-2alpha ChIP-chip profiling in intestinal epithelial cells

Project description:Intestinal epithelia exist in a uniquely dynamic oxygen tension microenvironment. Adaptive responses to hypoxia in mammalian cells are regulated largely by hypoxia inducible factor (HIF) transcriptional complexes. Functional HIF exists as an obligate alpha/beta heterodimer, comprising both a constitutive subunit (HIF-1beta), and an oxygen-labile regulatory (alpha) component. To date, three regulatory subunits have been identified, namely HIF-1alpha, HIF-2alpha, and HIF-3alpha, with the highest level of sequence homology conserved between HIF-1alpha and HIF-2alpha. Despite their concurrent expression in intestinal epithelial cells, HIF-1 and HIF-2 play non-redundant roles in the regulation of an overlapping but distinct set of gene targets. In this study, we performed ChIP-on-chip analysis of chromatin isolated from hypoxic intestinal epithelia to delineate HIF-1 and HIF-2 specific loci. Comparison of HIF-1alpha ChIP-chip and HIF-2alpha ChIP-chip to map HIF-1- and HIF-2-specific gene targets across the genome.

2013-11-05 | E-GEOD-43108 | biostudies-arrayexpress

Whole heart response to stable HIF-1alpha overexpression

Project description:An oxygen stable form of HIF-1alpha was overexpressed in the hearts of mice, under tet-off control. Bi-allelic transgenic mice were created by crossing alpha-MHC promoter/tet transactivating protein expressing mice with tet responsive element promter/stable HIF-1alpha protein expressing mice. Mice were either, maintained on Doxycycline (inhibiting the expression of the HIF-1alpha transgene) or removed from doxycycline (inducing expression) for one or three days.

2010-05-15 | E-GEOD-12673 | biostudies-arrayexpress

HIF-1alpha and HIF-2alpha ChIP-chip profiling in intestinal epithelial cells

2013-11-05 | GSE43108 | GEO

Chip-Seq analysis of HAUSP and HIF-1alpha

Project description:We reported that HAUSP (USP7) deubiquitinase interacts with and deubiquitinates HIF-1α to increase its stability and functions. HAUSP, HIF-1alpha and CBP could form a complex to regulate histone modification and gene transcription

2016-01-13 | GSE76770 | GEO

Whole heart response to stable HIF-1alpha overexpression

Project description:An oxygen stable form of HIF-1alpha was overexpressed in the hearts of mice, under tet-off control.

2008-12-02 | GSE12673 | GEO

Impact of NFE2L1 knockout on gene expression

Project description:These files represent DMSO and bortezomib (200 nM, 4 h) treated Control (B2) and NFE2L1 KO1 (B4) and NFE2L1 KO2 (B6) A549 cells.

2022-01-01 | GSE182461 | GEO

Hif-1alpha deletion leads to adverse treatment efficacy in a mouse model of MLL-AF9 driven AML

Project description:This report explores the effect of Hif-1alpha deletion, using a conditional mouse model, together with standard chemotherapy regimen to evaluate leukemia stem cell (LSC) targeting in a murine model of MLL-AF9 driven acute myeloid leukemia (AML). This study reveals that Hif-1alpha-deleted leukemias displayed a faster disease progression after chemotherapy.

2019-01-23 | GSE119484 | GEO

ZNF207-YWHAZ Enhances Breast Cancer Proliferation and Chemotherapy Resistance by Activating the HIF-1alpha-PPARgamma-PKM2 Signaling Axis.

Project description:Hypoxia is closely linked to chemotherapy resistance and accelerates breast cancer progression. However, the underlying mechanism of resistance to hypoxic chemotherapy remains uncertain. ZNF207 was identified as a differentially expressed gene involved in hypoxia and chemotherapy resistance by RNA-sequencing array. ZNF207 expression was elevated in lung, breast, liver, colon, and ovarian cancers, and its positive expression was correlated significantly with advanced TNM stage, lymph node metastasis, and poor prognosis. ZNF207 overexpression promoted the proliferation, invasion capabilities, and stemness of breast cancer cells by activating the HIF-1alpha-PPAR-gamma-glycolysis signaling pathway. Notably, ZNF207 was directly bound to the coiled-coil domain of YWHAZ, thereby accelerating HIF-1alpha deacetylation in an HDAC4-dependent manner. Furthermore, ZNF207 might stabilize YWHAZ by inhibiting its degradation via TRIM67 through a ubiquitin-dependent mechanism. ZNF207 overexpression enhanced resistance to doxorubicin and vinorelbine. Conversely, ZNF207-DeltaGLE overexpression disrupted HIF-1alpha-PPAR-gamma-glycolysis signaling and abolished chemotherapy resistance. Additionally, ZNF207 expression was higher in patients with breast cancer who exhibited poor treatment outcomes (Miller/Payne grades 1-2) than in those with more favorable outcomes (Miller/Payne grades 3-5). Sappanchalcone, a specific ZNF207 inhibitor, impedes breast cancer progression while exerting a synergistic effect with chemotherapy. Our findings revealed that ZNF207 expression was elevated in breast cancer under hypoxic conditions, promoting proliferation and invasion by activating HIF-1alpha through accelerated deacetylation in a positive feedback loop. The interaction between ZNF207 and YWHAZ enhances HIF-1alpha stability, ultimately accelerating therapeutic resistance in breast cancer.

2024-10-16 | GSE279294 | GEO

ZNF207-YWHAZ Enhances Breast Cancer Proliferation and Chemotherapy Resistance by Activating the HIF-1alpha-PPARgamma-PKM2 Signaling Axis

2024-10-21 | GSE279443 | GEO

Tumor cell endogenous HIF-1alpha activity induces aberrant angiogenesis and interacts with TRAF6 pathway required for colorectal cancer development

Project description:Hypoxia and inflammation are key factors for colorectal cancer tumorigenesis. The colonic epithelium belongs to the tissues with the lowest partial pressure of oxygen in the body, and chronic inflammation is associated with an increased chance to develop colon cancer. How the colonic epithelium responds to hypoxia and inflammation during tumorigenesis remains to be elucidated. Here we show, that murine colon adenocarcinoma cells with attenuated response to hypoxia, due to a knock-down (KD) of HIF-1alpha produce smaller and less hypoxic tumors in an orthotopic mouse model when compared to tumors induced with control cells. HIF-1alpha-KD tumors showed more functional perfused vasculature associated with increased levels of vessel-stabilizing factors and reduced levels of pro-angiogenic factors, including extracellular matrix protein Cyr61/CCN1. Intratumoral injection of Cyr61 in HIF-1alpha-KD tumors revealed an in increased vessel permeability and tumor hypoxia. Further bioinformatics analysis identified a possible interaction between HIF-1alpha and TRAF6, an upstream effector of the NF-kappaB pathway that was confirmed by co-immunoprecipitation in MC-38 and CT26 colon adenocarcinoma cells. Down-regulation of TRAF6 resulted in virtual abrogation of orthotopic tumor growth. Subcutaneous TRAF6-KD tumors were smaller and contained reduced vessel size and differently polarized macrophages. These data demonstrate that the tumor cell response to increased hypoxia in the colon leads to promotion of non-functional angiogenesis, regulated by both hypoxia and TRAF6 pathways.

2020-11-09 | GSE155104 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data