Transcriptomics

Dataset Information

0

Effect of HIF-1alpha knockout in gene expression profile of osteosarcoma cells in vivo.


ABSTRACT: To explore in vivo changes in gene expression of osteosarcoma cells upon depletion of HIF-1alpha we performed RNAseq analysis using Mock control AXT cells and HIF-1alpha KO AXT cells. HIF1alpha was knocked out using CRISPR-Cas9 with two different target sequences. KO1-1 and KO1-2 cells are derived from target sequence#1:5’- AGATGTGAGCTCACATTGTGGGG -3’ (exon3) and KO2 cells are from #2:5’-GCTAACAGATGACGGCGACATGG-3’ (exon5). AXT cells were established from BMSCs of Ink4a/Arf null mouse by overexpressing human c-MYC (Shimizu T, et al. Oncogene, 2010).

ORGANISM(S): Mus musculus

PROVIDER: GSE307480 | GEO | 2026/01/04

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

2013-11-05 | E-GEOD-43108 | biostudies-arrayexpress
2010-05-15 | E-GEOD-12673 | biostudies-arrayexpress
2013-11-05 | GSE43108 | GEO
2016-01-13 | GSE76770 | GEO
2008-12-02 | GSE12673 | GEO
2022-01-01 | GSE182461 | GEO
2019-01-23 | GSE119484 | GEO
2024-10-21 | GSE279443 | GEO
2024-10-16 | GSE279294 | GEO
2020-11-09 | GSE155104 | GEO