Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Decoy Antibodies Block Extracellular HSP70, Prevent Self Signaling and Inhibit Melanoma Cell Survival

ABSTRACT: Melanoma cells actively secrete melanosomes-large, extracellular vesicles (EVs) enriched with oncogenic factors that reprogram the tumor microenvironment, enhance self-signaling, and promote tumor growth. Despite their abundance and immunogenic potential, humoral responses to melanoma-derived melanosomes remain unexplored. Here, we identify a novel immune surveillance mechanism in which melanosome-elicited decoy antibodies target melanoma-derived melanosomes by binding to the extracellular form of heat shock protein 70 (HSP70), a chaperone broadly implicated in cancer cell survival and stress adaptation. Anti-HSP70 decoy antibodies potently and effector-independently inhibit growth and survival of both murine and human melanoma cells and suppress key transcriptional programs involved in proliferation, cytoskeletal dynamics, and metabolism. In a preclinical B16 melanoma model, prophylactic administration of decoy monoclonal antibodies Mel322-34 and Mel321-35 conferred significant survival benefits of 27% and 48%, respectively. Strikingly, anti-HSP70 antibodies were enriched in the sera of melanoma patients achieving complete responses to immune checkpoint blockade, in contrast to non-responders with progressive disease. Collectively, our findings uncover a novel EV-antibody axis as a promising avenue to block cancer-promoting signaling pathways. Decoy autoantibodies targeting the extracellular form of HSP70 advance the understanding of tumor-intrinsic vulnerability and promote biomarker-driven immunotherapy in melanoma.

ORGANISM(S): Mus musculus

PROVIDER: GSE319156 | GEO | 2026/02/23

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Decoy Antibodies Block Extracellular HSP70, Prevent Self Signaling and Inhibit Melanoma Cell Survival

Project description:Decoy Antibodies Block Extracellular HSP70, Prevent Self Signaling and Inhibit Melanoma Cell Survival

| PRJNA1422219 | ENA

Identification of HSP70 family proteins as targets of anti-melanosome monoclonal antibodies by immunoprecipitation and LC–MS/MS

Project description:This dataset contains proteomic analyses performed to identify the molecular targets of three anti-melanosome monoclonal antibodies (mAbs): Mel321-31, Mel322-34, and Mel321-35. These antibodies were generated following immunization of mice with purified melanosomes and were shown to bind melanosomes by ELISA and flow cytometry. To determine their protein targets, melanosomal lysates were subjected to immunoprecipitation using each mAb. An isotype control antibody (mGO.53), which does not bind melanosomes, was used to define background binding. Each antibody condition was analyzed in four independent replicates (n=4), resulting in a total of 16 samples (3 experimental antibodies + 1 isotype control). Enriched proteins were identified by label-free quantitative LC–MS/MS and statistically compared to the isotype control group. The analysis revealed significant enrichment of HSP70 family members (HspA1A, HspA1L, HspA5, and HspA8), identifying HSP70 proteins as the primary targets of the anti-melanosome mAbs.

2026-02-23 | PXD074667 | Pride

Expression profiling of fibroblasts treated with miR-211 and miR-320c

Project description:mRNA profiles generated from primary fibroblast upon treatment with miR-211, miR-302 or melanoma melanosomes. Abstract: Melanoma originates in the epidermis and enters the metastatic and lethal phase upon invasion into the dermis. However, the interactions between melanoma cells and the dermis prior to this invasion have been poorly studied. Here we uncover that melanoma cells directly affect the formation of the dermal tumor niche by microRNA (miRNA) trafficking prior to invading the dermis. Melanocytes, the cells of melanoma origin, are specialized in trafficking of pigment vesicles, termed melanosomes and, interestingly, melanoma cells retain this trafficking ability. In melanoma in-situ specimens, we found melanosome markers in distal fibroblasts prior to the invasion of melanoma cells into the dermis. Melanoma-derived melanosomes carry miRNAs into primary fibroblasts that trigger changes in the fibroblasts, including increased proliferation, migration, and expression of pro-inflammatory genes, all known features of cancer-associated fibroblasts (CAFs). Specifically, we found that melanosomal miRNA-211 directly targets IGF2R and leads to MAPK signaling activation in fibroblasts, which reciprocally encourages melanoma growth. Treatment of melanoma cells with a melanosome release-inhibitor prevented CAF formation. Since the first interaction of melanoma cells with blood vessels occurs in the dermis, our data suggest a promising opportunity to block melanoma cell invasion by preventing the formation of the dermal tumor niche. In the paper we showed the 10% of most differentially expressed mRNA upon miR-211, miR-320c and melanosomes treatment and overlap of 2000 downregulated mRNA upon miR-211 and melanosomes treatment with predicted target gene miR-211 and CAFs related genes Expresssion profiling was performed for primary fibroblasts transfected with miRNA-211 mimic and miRNA-320c mimic.

2016-08-09 | E-GEOD-72619 | biostudies-arrayexpress

Second-Hand Melanoma Melanosomes Regulate Diversity Among Tumor-Associated Macrophages

Project description:Extracellular vesicles (EVs) are a key form of cell-to-cell communication. Here we reveal a new mode of communication involving the large EVs, melanosomes. Unlike small EVsexosomes, which are dissolved in the receiver cell, melanosomes stay intact within them, gain a unique protein signature, and can then be further transferred to another cell, a state we term “second-hand EVs”. We found that melanoma-secreted melanosomes uptaken by and then released from epidermal keratinocytes or dermal fibroblasts can be further engulfed by resident macrophages. The respective consequence for macrophages is polarization into pro-tumor or pro-immune-cell-infiltration phenotypes. Fibroblasts load melanosomes with AKT1, which induces VEGF secretion from macrophages in an mTOR-dependent manner, promoting angiogenesis and metastasis in-vivo. In melanoma patients, macrophages co-localized with AKT1, were correlated with disease aggressiveness, and immunotherapy non-responders were enriched in macrophages containing melanosome markers. Thus, the network of interactions via second-hand EVs helps form the metastatic niche. Since macrophage heterogeneity is pivotal in advancement of cancer, our data suggest an opportunity to halt melanoma progression by blocking the melanosome cues of macrophage diversification.

2023-12-31 | PXD046421 | Pride

Second-Hand Melanoma Melanosomes Regulate Diversity Among Tumor-Associated Macrophages

Project description:Extracellular vesicles (EVs) are a key form of cell-to-cell communication. Here we reveal a new mode of communication involving the large EVs, melanosomes. Unlike small EVs, which are dissolved in the receiver cell, melanosomes stay intact within them, gain a unique protein signature, and can then be further transferred to another cell, a state we term “second-hand EVs”. We found that melanoma-secreted melanosomes uptaken by and then released from epidermal keratinocytes or dermal fibroblasts can be further engulfed by resident macrophages. The respective consequence for macrophages is polarization into pro-tumor or pro-immune-cell-infiltration phenotypes. Fibroblasts load melanosomes with AKT1, which induces VEGF secretion from macrophages in an mTOR-dependent manner, promoting angiogenesis and metastasis in-vivo. In melanoma patients, macrophages co-localized with AKT1, were correlated with disease aggressiveness, and immunotherapy non-responders were enriched in macrophages containing melanosome markers. Thus, the network of interactions via second-hand EVs helps form the metastatic niche. Since macrophage heterogeneity is pivotal in advancement of cancer, our data suggest an opportunity to halt melanoma progression by blocking the melanosome cues of macrophage diversification.

2023-12-31 | GSE246446 | GEO

Expression profiling of fibroblasts treated with miR-211 and miR-320c

2016-08-09 | GSE72619 | GEO

Analysis of melanosomal miRNAs

Project description:miRNA microarray profiling was performed for MNT-1 cells, pre-mature and mature melanosomes extracted from MNT-1 cells. In order to reveal the miRNAs that are most abundant in mature melanosomes, the most highly expressed miRNAs from mature melanosomes were compared with expression levels in pre-mature melanosomes. The analysis revealed five miRNAs that were highly expressed in mature melanosomes and had been previously associated with melanoma. Total RNA was extracted from MNT-1 cells (2 replicates), pre-mature and mature melanosomes. The melanosomes were either treated with RNase prior to RNA extraction (2 replicates each) or untreated (1 replicate each). Melanosomes were extracted from MNT-1 melanoma cells by sucrose-based density gradient ultracentrifugation. The treatment of melanosomes with RNase prior to RNA extraction was performed in order to remove any kind of RNA that may interact with or stick unspecifically to the outer side of the melanosome membrane. After 10 mins of RNAse treatment, RNase inhibitor was added. The samples of MNT-1 cells and untreated melanosomes were considered for the normalization, but not for further analyses. Microarray Unit of the Core Facility Genomics and Proteomics DKFZ

2016-08-09 | E-GEOD-72337 | biostudies-arrayexpress

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

Cell cycle motif decoy oligos

2012-08-23 | GSE39572 | GEO

Analysis of melanosomal, exosomal and cellular miRNAs of melanoma cells

Project description:miRNA microarray profiling was performed for exosomes and secreted melanosomes of MNT-1 cells as well as WM3682 and WM3314 cells and melanosomes isolated from cell homogenates. The aim of this study is to compare the miRNA content of exosomes and secreted melanosomes and to assess differences in the miRNA profiles of different melanoma cell lines and their melanosomes. Total RNA was extracted from MNT-1 exosomes and secreted melanosomes (2 replicates each) that were isolated from the conditioned medium of MNT-1 melanoma cells by differential ultracentrifugation. In addition, total RNA was isolated from WM3682 and WM3314 melanoma cells and melanosomes (1 replicate each). These latter melanosomes were isolated from cell homogenates by filtration through a 0.45 Âµm filter, followed by FACS sorting. Contributor: Microarray Unit of the Core Facility Genomics and Proteomics DKFZ

2016-08-09 | E-GEOD-79411 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data