Genome-wide localization of Smc1, Smc3 and CTCF in mouse B cells.
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE43594 | GEO | 2013/10/11
SECONDARY ACCESSION(S): PRJNA186794
REPOSITORIES: GEO
Similar Datasets
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to switch regions and by the subsequent generation and resolution of dsDNA breaks (DSBs). During, CSR the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and switch regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we show that during CSR, AID associates with subunits of cohesin, a complex previously implicated in DNA repair and in the formation of DNA loops between enhancers and promoters. By ChIP-Seq experiments, we find that Cohesin is dynamically recruited to the IgH locus during CSR and that knockdown of Cohesin or its regulatory subunits results in impaired CSR and abnormal DSB resolution. Our results are consistent with a model in which Cohesin controls the formation of long-range DNA loops at the IgH locus and the resolution of DSBs generated during CSR. Smc1, Smc3 and CTCF were immunoprecipitated from resting or in vitro activated B cells.
2013-10-11 | E-GEOD-43594 | biostudies-arrayexpress
Project description:High-throughput genome-wide translocation sequencing (HTGTS) is a robust approach to identify genome-wide translocation junctions. We performed HTGTS to study the fate of introduced c-myc DSBs in mouse splenic B cells activated for activation cytidine deaminase (AID)-dependent class switch recombination (CSR). We found frequent translocations of c-myc DSBs to AID-initiated DSBs in IgH switch regions in wild-type (WT) and ATM-deficient B cells. However, c-myc also translocated frequently to newly generated DSBs within a 35-megabase region downstream of IgH in ATM-deficient, but not WT, CSR-activated B cells. Moreover, we found such DSBs and translocations in activated B cells that did not express AID or undergo CSR. These findings indicate that ATM deficiency leads to formation of chromosome 12 dicentrics via RAG-initiated IgH DSBs in progenitor B cells and that these dicentrics can be propagated developmentally into mature B cells where they generate new DSBs downstream of IgH via breakage-fusion-bridge cycles. Preparation of libraries from WT or ATM-deficient activated by a-CD40/IL4 or RP105.
2014-06-18 | E-GEOD-58599 | biostudies-arrayexpress
Project description:During Class Switch Recombination (CSR) B cells replace the Igh Cμ/δ exons with another downstream constant region exon (CH), altering the antibody isotype. CSR occurs through the introduction of AID-mediated double strand break (DSBs) in switch regions and subsequent ligation of broken ends. Here we developed an assay to investigate the dynamics of DSB introduction in individual cells. We demonstrate that the upstream switch region Sμ is always targeted first during recombination and that the mechanism underlying this control relies on 53BP1. Surprisingly, regulation of break order occurs through residual binding of 53BP1 to chromatin before the introduction of damage and independent of its established role in DNA repair. Using chromosome conformation capture we show that 53BP1 mediates changes in chromatin architecture that affect break order. Finally, our results explain how changes in Igh architecture in the absence of 53BP1 could promote inversional rearrangements that compromise CSR. High Resolution 4C was performed in resting and activated B cells using a bait on the Eμ enhancer
2016-06-16 | E-GEOD-81180 | biostudies-arrayexpress
Project description:High-throughput genome-wide translocation sequencing (HTGTS) is a robust approach to identify genome-wide translocation junctions. We performed HTGTS to study the fate of introduced c-myc DSBs in mouse splenic B cells activated for activation cytidine deaminase (AID)-dependent class switch recombination (CSR). We found frequent translocations of c-myc DSBs to AID-initiated DSBs in IgH switch regions in wild-type (WT) and ATM-deficient B cells. However, c-myc also translocated frequently to newly generated DSBs within a 35-megabase region downstream of IgH in ATM-deficient, but not WT, CSR-activated B cells. Moreover, we found such DSBs and translocations in activated B cells that did not express AID or undergo CSR. These findings indicate that ATM deficiency leads to formation of chromosome 12 dicentrics via RAG-initiated IgH DSBs in progenitor B cells and that these dicentrics can be propagated developmentally into mature B cells where they generate new DSBs downstream of IgH via breakage-fusion-bridge cycles.
2014-06-18 | GSE58599 | GEO
Project description:After immunization or infection, activation-induced cytidine deaminase (AID) initiates diversification of immunoglobulin (Ig) genes in B cells, introducing mutations within the antigen binding V regions (somatic hypermutation, SHM) and double-strand DNA breaks (DSBs) into switch (S) regions, leading to antibody class switch recombination (CSR). Using a candidate approach, AID has been shown to initiate mutations at numerous non-Ig genes in B cells in Peyer’s patches. However, it is not known if during B cell activation, AID also induces DNA breaks at genes other than IgH genes, which would lead to genomic instability and malignancy. Using a non-biased genome-wide approach, we have identified hundreds of reproducible AID-dependent DSBs in mouse splenic B cells shortly after induction of CSR in culture. Most interestingly, AID induces DSBs at sites syntenic with sites of translocations, deletions, and amplifications found in human B cell lymphomas, including within the oncogene B cell lymphoma11a (bcl11a)/evi9. The AID-dependent DSBs are not restricted to transcribed regions, and they frequently occur within repeated sequence elements, including CA and non-CA repeats, and SINEs. Comparison of Nbs1 binding sites in wild-type vs. aid-/- splenic B cells induced to undergo CSR; aid-dependent Nbs1 sites correlated with gene transcription (RNA Pol2).
2011-01-21 | E-GEOD-24827 | biostudies-arrayexpress
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.
2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress
Project description:In a B lymphocyte immunoglobulin heavy chain locus (IgH), a developmentally assembled V(D)J exon encoding an antibody variable region lies upstream of exons encoding a m constant region (Cm), allowing generation of mIgH chain transcripts and IgM-class antibodies1. Mouse IgH class switch recombination (CSR) replaces Cmwith one of 6 sets of constant region exons (CHs) that lie 100-200kb downstream1. Each CH is flanked upstream by a promoter, non-coding I-exon, and long repetitive switch (S) region1,2. Cytokines/activators induce specific I-promoter transcription and activation-induced cytidine deaminase (AID)2,3. AID is transcriptionally-targeted to initiate DNA breaks in Sm and activated downstream acceptor S regions, which are joined in deletional orientation to complete CSR4,5. 3’IgH regulatory region (3’IgHRR) enhancers control upstream I promoters and, thereby, CSR via linear competition involving I promoter/3’IgHRR interactions6-11. Here, we report that synapsis of regulatory elements, S regions and DSBs for CSR is achieved by chromatin loop extrusion. In naive B cells, 3’IgHRR enhancers and adjacent 3’IgH CTCF-binding elements (CBEs) interact via loop extrusion with the upstream Igh intronic enhancer (iEm)/Sm locale to generate dynamic 200kb 3’Igh basal loop. In CSR-activated B cells, induced transcription from I-promoters within this basal loop generates dynamic sub-loops that directionally align Sm and target S regions near the 3’IgHRR for CSR. In CH12F3 B lymphoma cells, inactivation of the constitutively active Ia-promoter abrogates looping and CSR to Sa, while activating transcription, looping, and CSR to upstream S regions. CBEs inserted upstream of Ia in convergent orientation with 3’IgH CBEs generate sub-loops that activate inversional Sa CSR. In I-promoter-deleted CH12F3 cells, this ectopic CBE-based sub-loop inactivates upstream S region CSR, while transcriptionally activating non-S region sequences adjacent to the inserted CBEs for S synapsis and CSR. Together, our findings implicate chromatin loop extrusion in the “unprecedented mechanism”5 by which Igh organization in cis promotes orientation-specific CSR DSB joining.
2019-09-25 | GSE130266 | GEO
Project description:In a B lymphocyte immunoglobulin heavy chain locus (IgH), a developmentally assembled V(D)J exon encoding an antibody variable region lies upstream of exons encoding a constant region (C), allowing generation of IgH chain transcripts and IgM-class antibodies1. Mouse IgH class switch recombination (CSR) replaces Cwith one of 6 sets of constant region exons (CHs) that lie 100-200kb downstream1. Each CH is flanked upstream by a promoter, non-coding I-exon, and long repetitive switch (S) region1,2. Cytokines/activators induce specific I-promoter transcription and activation-induced cytidine deaminase (AID)2,3. AID is transcriptionally-targeted to initiate DNA breaks in S and activated downstream acceptor S regions, which are joined in deletional orientation to complete CSR4,5. 3’IgH regulatory region (3’IgHRR) enhancers control upstream I promoters and, thereby, CSR via linear competition involving I promoter/3’IgHRR interactions6-11. Here, we report that synapsis of regulatory elements, S regions and DSBs for CSR is achieved by chromatin loop extrusion. In naive B cells, 3’IgHRR enhancers and adjacent 3’IgH CTCF-binding elements (CBEs) interact via loop extrusion with the upstream Igh intronic enhancer (iE)/S locale to generate dynamic 200kb 3’Igh basal loop. In CSR-activated B cells, induced transcription from I-promoters within this basal loop generates dynamic sub-loops that directionally align S and target S regions near the 3’IgHRR for CSR. In CH12F3 B lymphoma cells, inactivation of the constitutively active I-promoter abrogates looping and CSR to S, while activating transcription, looping, and CSR to upstream S regions. CBEs inserted upstream of I in convergent orientation with 3’IgH CBEs generate sub-loops that activate inversional S CSR. In I-promoter-deleted CH12F3 cells, this ectopic CBE-based sub-loop inactivates upstream S region CSR, while transcriptionally activating non-S region sequences adjacent to the inserted CBEs for S synapsis and CSR. Together, our findings implicate chromatin loop extrusion in the “unprecedented mechanism”5 by which Igh organization in cis promotes orientation-specific CSR DSB joining.
2019-09-25 | GSE130265 | GEO
Project description:In a B lymphocyte immunoglobulin heavy chain locus (IgH), a developmentally assembled V(D)J exon encoding an antibody variable region lies upstream of exons encoding a constant region (C), allowing generation of IgH chain transcripts and IgM-class antibodies1. Mouse IgH class switch recombination (CSR) replaces Cwith one of 6 sets of constant region exons (CHs) that lie 100-200kb downstream1. Each CH is flanked upstream by a promoter, non-coding I-exon, and long repetitive switch (S) region1,2. Cytokines/activators induce specific I-promoter transcription and activation-induced cytidine deaminase (AID)2,3. AID is transcriptionally-targeted to initiate DNA breaks in S and activated downstream acceptor S regions, which are joined in deletional orientation to complete CSR4,5. 3’IgH regulatory region (3’IgHRR) enhancers control upstream I promoters and, thereby, CSR via linear competition involving I promoter/3’IgHRR interactions6-11. Here, we report that synapsis of regulatory elements, S regions and DSBs for CSR is achieved by chromatin loop extrusion. In naive B cells, 3’IgHRR enhancers and adjacent 3’IgH CTCF-binding elements (CBEs) interact via loop extrusion with the upstream Igh intronic enhancer (iE)/S locale to generate dynamic 200kb 3’Igh basal loop. In CSR-activated B cells, induced transcription from I-promoters within this basal loop generates dynamic sub-loops that directionally align S and target S regions near the 3’IgHRR for CSR. In CH12F3 B lymphoma cells, inactivation of the constitutively active I-promoter abrogates looping and CSR to S, while activating transcription, looping, and CSR to upstream S regions. CBEs inserted upstream of I in convergent orientation with 3’IgH CBEs generate sub-loops that activate inversional S CSR. In I-promoter-deleted CH12F3 cells, this ectopic CBE-based sub-loop inactivates upstream S region CSR, while transcriptionally activating non-S region sequences adjacent to the inserted CBEs for S synapsis and CSR. Together, our findings implicate chromatin loop extrusion in the “unprecedented mechanism”5 by which Igh organization in cis promotes orientation-specific CSR DSB joining.
2019-09-25 | GSE130264 | GEO
Project description:In a B lymphocyte immunoglobulin heavy chain locus (IgH), a developmentally assembled V(D)J exon encoding an antibody variable region lies upstream of exons encoding a m constant region (Cm), allowing generation of mIgH chain transcripts and IgM-class antibodies1. Mouse IgH class switch recombination (CSR) replaces Cmwith one of 6 sets of constant region exons (CHs) that lie 100-200kb downstream1. Each CH is flanked upstream by a promoter, non-coding I-exon, and long repetitive switch (S) region1,2. Cytokines/activators induce specific I-promoter transcription and activation-induced cytidine deaminase (AID)2,3. AID is transcriptionally-targeted to initiate DNA breaks in Sm and activated downstream acceptor S regions, which are joined in deletional orientation to complete CSR4,5. 3’IgH regulatory region (3’IgHRR) enhancers control upstream I promoters and, thereby, CSR via linear competition involving I promoter/3’IgHRR interactions6-11. Here, we report that synapsis of regulatory elements, S regions and DSBs for CSR is achieved by chromatin loop extrusion. In naive B cells, 3’IgHRR enhancers and adjacent 3’IgH CTCF-binding elements (CBEs) interact via loop extrusion with the upstream Igh intronic enhancer (iEm)/Sm locale to generate dynamic 200kb 3’Igh basal loop. In CSR-activated B cells, induced transcription from I-promoters within this basal loop generates dynamic sub-loops that directionally align Sm and target S regions near the 3’IgHRR for CSR. In CH12F3 B lymphoma cells, inactivation of the constitutively active Ia-promoter abrogates looping and CSR to Sa, while activating transcription, looping, and CSR to upstream S regions. CBEs inserted upstream of Ia in convergent orientation with 3’IgH CBEs generate sub-loops that activate inversional Sa CSR. In I-promoter-deleted CH12F3 cells, this ectopic CBE-based sub-loop inactivates upstream S region CSR, while transcriptionally activating non-S region sequences adjacent to the inserted CBEs for S synapsis and CSR. Together, our findings implicate chromatin loop extrusion in the “unprecedented mechanism”5 by which Igh organization in cis promotes orientation-specific CSR DSB joining.
2019-09-25 | GSE130263 | GEO