Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Comparison of gene expression in embryos in wich Smicl has been knocked-down and in control embryos

ABSTRACT: Embryos were injected with either control or Smicl antisense morpholino oligonucleotides and harvested at Stage 10.5 for RNA analysis. Keywords: Knock-down analysis

ORGANISM(S): Xenopus tropicalis Xenopus laevis

PROVIDER: GSE4952 | GEO | 2009/05/30

SECONDARY ACCESSION(S): PRJNA95903

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Comparison of gene expression in embryos in wich Activin B has been knocked-down and in control embryos

Project description:Embryos were injected with either control or Activin antisense morpholino oligonucleotides and harvested at Stage 10.5 for RNA analysis. Keywords: Knock-down analysis

2007-05-04 | GSE4771 | GEO

Comparison of gene expression in embryos in wich Smicl has been knocked-down and in control embryos

Project description:Embryos were injected with either control or Smicl antisense morpholino oligonucleotides and harvested at Stage 10.5 for RNA analysis. Keywords: Knock-down analysis Embryos from three different spawnings where injected at one cell stage with either control or Smicl antisense morpholino oligonucleotides and cultured to early gastrula stage 10.5 for RNA isolation. Some embryos were cultured to further development to check their phenotypes. Each slide was hybridised with a mixture 1:1 of sample and control cDNAs, each labelled with a different dye. Hybridisations were carried out as dye-swapped technical replicates, therefore six microarray slides were hybridized

2010-05-18 | E-GEOD-4952 | biostudies-arrayexpress

Transcription profiling of Xenopus embryos in which MyoD expression was knocked-down with AMOs.

Project description:Embryos were injected with antisense Morpholino Oligonucleotides (AMOs) targetting MyoD. The transcriptional profile of these knock down embryos was compared with embryos injected with control morpholino (CMO).

2011-06-22 | E-MEXP-3272 | biostudies-arrayexpress

Transcription profiling of Xenopus laevis early gastrulation embryos injected with antisense oligonucleotides against TBP, TLF or TBP2

Project description:Xenopus laevis embryos were injected with antisense oligonucleotides against TBP, TLF or TBP2. Embryos were allowed to develop up to stage 7 (non-injected control embryos) or stage 10.5 (early gastrula, control and antisense injected embryos) and subsequently collected for RNA and protein isolation. The transcriptome profile of antisense injected and control embryos was compared.

2007-08-29 | E-MEXP-1009 | biostudies-arrayexpress

Transcription profiling of zebrafish embryos with dpf3 knocked down for morpholino

Project description:An experiment was performed to analyze the effect of knockdown of dpf3 during zebrafish embryogenesis.Morpholino against dpf3 and control morpholino were injected into eggs and eggs were kept under standard conditions for 72 hours. Embroys were harvested, total RNA was extracted and used for microarray analysis.

2008-08-01 | E-TABM-354 | biostudies-arrayexpress

Comparison of gene expression in embryos in wich the nodal-related genes have been inhibited and in control embryos

Project description:Embryos were injected with either water or Cerberus Short mRNA and harvested at Stage 10.5 for RNA analysis. Keywords: Knock-down analysis

2007-05-05 | GSE4777 | GEO

Differential expression analysis of Gcn5 knockdown embryos at early developmental stage 10.5 in Xenopus laevis

Project description:We sequenced cDNA prepared from ribosomal RNA depleted total RNA of 10-10 embryos injected with Gcn5-antisense oligonucleotides and with water to create expression profiles of Gcn5 knockdown and control, respectively, in Xenopus laevis at early embryonic developmental stage 10.5. (according to Nieuwkoop and Faber), and we executed differential expression analysis of sequence count data (DEseq).

2016-03-07 | GSE76991 | GEO

Differential expression analysis of triple knockdown of TBP and TBP-related factors (TKD) in Xenopus laevis embryos at early developmental stage 10.5

Project description:We sequenced cDNA prepared from ribosomal RNA depleted total RNA of 10-10 embryos co-injected with TBP-,TBP2- and TLF-AS antisense oligonucleotides and with water to create expression profiles of triple knockdown of TBP/TBP-related factors (TKD) and control, respectively, in Xenopus laevis at early developmental stage 10.5. (according to Nieuwkoop and Faber). We executed differential expression analysis of sequence count data (DEseq).

2016-03-07 | GSE76994 | GEO

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

Project description:A zebrafish model of arterial tortuosity syndrome (ATS) was generated by knocking down the slc2a10/glut10 gene using antisense morpholino oligonucleotides (MO). Control morpholino treated embryos were used as controls. The samples were collected for gene expression profiling at 48 hours post fertilization. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555

2011-12-17 | GSE34508 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data