Dataset Information

Genome-wide analysis reveals characteristics of off-target sites bound by the Cas9 endonuclease

ABSTRACT: RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide

ORGANISM(S): Homo sapiens

PROVIDER: GSE55887 | GEO | 2014/05/18

SECONDARY ACCESSION(S): PRJNA241244

REPOSITORIES: GEO

ACCESS DATA

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Genome-wide analysis reveals characteristics of off-target sites bound by the Cas9 endonuclease

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure