Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Influences of fibulin-5 and cleaved fibulin-5 on gene expression patterns of fibroblasts

ABSTRACT: To investigate the relevance and the impact of the cleaved FBLN5 variant on fibroblast’s physiology, we have employed whole genome microarrays. Human neonatal dermal fibroblasts from three different donors were seeded in duplicates on plates pre-coated with FBLN5, cleaved FBLN5 or heat denatured BSA as a control. After cultivation for 24 h, RNA was isolated and microarrays were performed. Statistical analysis of microarrays resulted in 367 genes significantly differentially expressed in cells cultured on a FBLN5 matrix and 525 genes differentially expressed in cells cultured on a cleaved FBLN5 matrix compared to control (adjusted p-value <0.05). To further validate these gene expression changes identified by microarray analysis 10 randomly choosen genes were reanalyzed by qRT-PCR (quantitative real time polymerase chain reaction). In nine cases the fold changes measured by qRT-PCR were comparable with those measured by microarray analysis, revealing reproducibility and validity of analysis.

ORGANISM(S): Homo sapiens

PROVIDER: GSE58635 | GEO | 2014/07/20

SECONDARY ACCESSION(S): PRJNA253047

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Influences of fibulin-5 and cleaved fibulin-5 on gene expression patterns of fibroblasts

Project description:To investigate the relevance and the impact of the cleaved FBLN5 variant on fibroblastM-bM-^@M-^Ys physiology, we have employed whole genome microarrays. Human neonatal dermal fibroblasts from three different donors were seeded in duplicates on plates pre-coated with FBLN5, cleaved FBLN5 or heat denatured BSA as a control. After cultivation for 24 h, RNA was isolated and microarrays were performed. Statistical analysis of microarrays resulted in 367 genes significantly differentially expressed in cells cultured on a FBLN5 matrix and 525 genes differentially expressed in cells cultured on a cleaved FBLN5 matrix compared to control (adjusted p-value <0.05). To further validate these gene expression changes identified by microarray analysis 10 randomly choosen genes were reanalyzed by qRT-PCR (quantitative real time polymerase chain reaction). In nine cases the fold changes measured by qRT-PCR were comparable with those measured by microarray analysis, revealing reproducibility and validity of analysis. Fibulin-5 and cleaved FBLN5 contributed to changes in expression pattern of human neonatal dermal fibroblasts after cultivation for 24 h. Three different donors were used in technical duplicates.

2014-07-20 | E-GEOD-58635 | biostudies-arrayexpress

Expression data from cleaved CD95L treated human Th17 and Treg cells.

Project description:Th17 and Treg cells show a different infiltration and migrations pattern in inflamed skin from systemic lupus erythematosus patients. This distribution strongly correlates with the plasm levels of cleaved CD95L (cl-CD95L). To identify the mechanisms that underly this difference in migration, we used microarrays to identify differences in RNA expression induced by cl-CD95L treatment on Th17 and Treg cells from healthy donors.

2016-03-05 | GSE78909 | GEO

Expression data from vaginal tissue from estrogen-treated WT and Fbln5-/- mice

Project description:We used microarrays to detail the global program of gene expression changes in wild type and Fbln5-/- adult mice. Estrogen status was controlled

2012-08-22 | GSE40249 | GEO

Large-scale profiling of unexpected tryptic cleaved sites at ubiquitinated lysines

Project description:Trypsin specifically cleaves the C-terminus of lysine and arginine residues and is assumed to fails to cleave ubiquitin-modified sites. Based on this perception, the irregularly-cleaved ubiquitinated peptides were often regarded as false positives and discarded in proteomic analysis. Interestingly, unexpected cleavage at the modified ubiquitin K48 site has been reported, suggesting the latent ability of trypsin to cleave the C-terminus of modified lysines. However, it remains unclear whether other trypsin-cleavable ubiquitinated sites are present. In this study, we verified the ability of trypsin in cleaving K6 and K63 besides K48 chains. The missed cleaved K-ε-GG peptide was quickly and efficiently generated during trypsin digestion, whereas irregularly-cleaved ones were produced more slowly and with much lower efficiency. To confirm the availability of K-ε-GG antibody purified ubiquitinome datasets, the K-ε-GG antibody was proved to efficiently enrich the irregularly-cleaved peptides. More than 3,000 irregularly-cleaved ubiquitylated peptides were identified in the K-ε-GG antibody and UbiSite based datasets, and the frequency of lysine upstream of the irregularly-cleaved modified K was significantly enriched. The kinetic activity of trypsin in cleaving modified lysine residues was further elucidated. We suggest that irregularly-cleaved K-ε-GG sites with high identification scores should be considered as true positives in future ubiquitome analyses.

2023-01-10 | PXD039353 | iProX

Identifying cleaved and noncleaved targets of small interfering RNAs and microRNAs in mammalian cells by SpyCLIP

Project description:we report a strategy to establish a comprehensive picture of siRNA cleaved and noncleaved off-targets by performing SpyCLIP using wild-type and catalytically inactive AGO2 mutants in parallel. Additionally, we investigated naturally occurring cleavage events mediated by endogenous miRNAs using the same strategy. Our results demonstrated that AGO2 SpyCLIP is a powerful method to identify both cleaved and noncleaved targets of siRNAs, providing valuable information for improving siRNA design rules

2020-12-01 | GSE145438 | GEO

High density analysis of the tailing and trimming patterns of RISC-cleaved MYB33 and SPL13 transcripts in Arabidopsis heso1 and urt1 mutants

Project description:Using 3' RACEseq method, we compared the tailing and nibbling patterns of RISC-cleaved MYB33 and SPL13 transcripts between wild-type plants and mutant plants depleted for the terminal uridylyltransferases (TUTases) HESO1 and URT1. Our data reveal a major and minor role for HESO and URT1, respectively, in the uridylation of RISC-cleaved transcripts.

2018-10-05 | GSE115470 | GEO

Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0

2014-03-08 | GSE47121 | GEO

Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0

Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE. GMUCT libraries were made from flower buds of the Arabidopsis thaliana accession Columbia (Col-0) and three human cell lines—the cervical cancer cell line HeLa, human embryonic kidney 293 T (HEK293T) cell line, and the human chronic myelogenous leukaemia cell line K562—two replicates of each. Matched mRNA-seq libraries were made for each Col-0 GMUCT replicate. These libraries were sequenced on the Illumina HiSeq 2000 and the reads were trimmed to remove the adapter sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCA). The abundance of each unique read was determined, and unique reads were mapped to the Arabidopsis and human genomes, respectively.

2014-03-08 | E-GEOD-47121 | biostudies-arrayexpress

Chip-seq analysis of meiotic Cohesin (mei-Cohesins) subunit REC8 cleaved by separase (REC8*), and SMC3 in Macaca fascicularis testis

Project description:The study aimed to map epigenomic locations of separase-cleaved REC8 using chromatin IP analyzed by high-throughput sequencing on purified germ cells from M. fascicularis testis

2022-11-07 | GSE201989 | GEO

PARN mediates 3'-end trimming of Argonaute-cleaved precursor microRNAs

Project description:microRNAs (miRNAs) are typically generated as ~22-nucleotide double-stranded RNAs via processing of precursor hairpins by the RNase III enzyme Dicer, after which they are loaded into Argonaute (Ago) proteins to form RNA-induced silencing complex (RISC). However, the biogenesis of miR-451, an erythropoietic miRNA conserved in vertebrates, does not require Dicer processing. Instead, the short pre-miR-451 precursor hairpin is directly loaded into Ago, followed by cleavage of the 3' arm and trimming of the 3' end to the mature length by PARN. Here we show the in vivo activity of miR-430 Ago2-hairpin, a canonical microRNA engineered to fit the structure of miR-451 and hence become Ago2-dependent. Moreover, we test a modified miR-430 Ago2-haipin with 3x phoshorothioate bonds that impairs trimmng. Surprisingly, our data show that trimming of Ago-cleaved pre-miRNAs is not essential for target silencing, indicating that RISC is functional with miRNAs longer than 22-nucleotides. Rescue of MZdicer zebrafish mutant with the injection of trimmable and nontrimmable miR-430 Ago2 hairpins: Transcriptome of wild type, MZdicer mutant, and MZdicer mutant micoinjected with miR-430 duplex, miR-430 (Ago2-haripin), miR-430 (Ago2-haripin 3xPhosphorothioate)

2013-11-13 | E-GEOD-51036 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data