Myc mild overexpression in the heart in a mosaic fashion induces matabolic changes and triggers hipertrophic protection pathways without a pathological phenotype
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE58858 | GEO | 2014/09/26
SECONDARY ACCESSION(S): PRJNA253823
REPOSITORIES: GEO
Similar Datasets
Project description:Recently, it was described that mammalian cells are able to eliminate those with relative lower Myc levels in the epiblast through cell competition. We have described that cardiomyocytes during heart development are also able to complete eliminating cells with lower Myc levels. We have also shown that adult cardiomyocytes respond in the same way over long periods of time when cell competition is induced by overexpressing Myc in a mosaic fashion. We therefore have developed an RNASeq assay to further understand the mechanism of elimination of WT cells and the effect of mild Myc overexpression in cardiomyocytes. Myc overexpression in a mosaic fashion in adult cardiomyocytes, 2 hearts were analyzed and two wild type littermates were used as controls
2014-09-26 | E-GEOD-58858 | biostudies-arrayexpress
Project description:The goal of this study is to analyse the transcriptome of WT and Myc-overexpressing ESCs in iMOS T1-Myc mosaic cultures.
2017-09-29 | GSE100570 | GEO
Project description:During the progression of cardiac hypertrophy, cardiomyocytes accelerate RNA biogenesis to meet increasing metabolic demands under exogenous hypertrophic stimuli. We have elucidated the quantitative kinetics of RNA in c-Myc (Myc)-mediated hypermetabolic analytical model using cultured neonatal rat cardiomyocytes. Chromatin immunoprecipitation and high-throughput sequencing demonstrate that overexpressed Myc binds to a specific set of genes directly in cardiomyocytes and recruits RNA polymerase II to these genes.
2016-07-10 | GSE78934 | GEO
Project description:miR-222 overexpression leads to promotion of proliferation and hypertrophy and inhibition of apoptosis in in primary neonatal rat ventricular cardiomyocytes (NRVMs). Isolated primary neonatal rat ventricular cardiomyocytes were plated in 6 cm BD Primaria tissue culture dishes. Transfection of microRNA precursors or scramble control (0.4 μM) was carried out using Lipofectamine RNAiMAX (Invitrogen) as recommended by the manufacturer. Forty-eight hours after transfection, RNAs from cultured cells and tissues were isolated with Tryzol (Invitrogen) following the manufacturesâ?? manuals. Total RNA was harvested and submitted to the Dana-Farber Cancer Institute Molecular Diagnostics Laboratory for assay. These results revealed miR-222 regulated gene expression in primary neonatal rat ventricular cardiomyocytes. Gene expression in NRVM cells tranfected with control scramble precursor (4 samples) or miR-222 precursor (4 smaples ) was evaluated using Affymetrix Rat Genome 230 v2.0.
2016-03-03 | E-GEOD-59641 | biostudies-arrayexpress
Project description:PamcKO/cKO mice, with loxp sites flanking exons previously deleted in the global Pam knockout, were created, viable and equivalent to wildtype mice in every test. Eliminating Pam expression in excitatory forebrain neurons reduced anxiety-like behavior, increased locomotor responsiveness to cocaine and improved thermoregulation in the cold. Eliminating Pam expression in cardiomyocytes increased anxiety-like behavior, improved thermoregulation and markedly diminished atrial levels of pro-atrial natriuretic peptide. RNASeq analysis of atria revealed a set of PAM-regulated transcripts related to cardiac function.
2019-08-13 | GSE132180 | GEO
Project description:To investigate the functions of AMPK activation on maturation of hiPSC derived cardiomyocytes, we treated 3D hiPSC derived cardiomyocytes with AMPK activator EX229 at 10 µM for 7 days. Transcriptomic analyse was performed to identify molecular actions of AMPK activation.
2022-05-27 | GSE203480 | GEO
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
2011-05-01 | E-MEXP-2389 | biostudies-arrayexpress
Project description:Stem cell competition controls organ size, maintains tissue homeostasis and optimizes long-term tissue function through eliminating cells less fit than their neighbors, but whether competitive interaction occurs between neural stem cells in the developing brain and its mechanistic drivers remains enigmatic. We applied single-cell RNA sequencing of mouse E11.5 medial cortex and bulk RNA sequencing of AnnexinV positive, PI negative cells to identify the loser cell in the natural state.
2023-03-10 | GSE203163 | GEO
Project description:The heart adapts to increased workload through hypertrophic growth of cardiomyocytes. Although beneficial when induced physiologically by exercise, pathological cues including hypertension cause reexpression of fetal genes and dysfunctional hypertrophy, with lasting consequences for cardiac health. We hypothesised that these differences are driven by changes in chromatin-encoded cellular memory. We generated genome-wide maps of transcription and of two stable epigenetic marks, H3K9me2 and H3K27me3, specifically in hypertrophied cardiomyocytes, by selectively flow-sorting their nuclei. This demonstrated a pervasive loss of euchromatic H3K9me2 specifically upon pathological but not physiological hypertrophy, derepressing genes associated with pathological hypertrophy. Levels of the H3K9 methyltransferases, G9a and GLP, were correspondingly reduced. Importantly, pharmacological or genetic inactivation of these enzymes was sufficient to induce pathological hypertrophy and the dedifferentiation associated with it. These findings suggest novel therapeutic opportunities by defining an epigenetic state of cardiomyocytes, acquired during maturation, which is required for maintaining cardiac health.
2016-12-05 | GSE66653 | GEO
Project description:After reporting that mice with inducible CM-specific Wnt activation (β-catΔex3) mimic pathological remodelling condition and heart failure, we further explored the cardiac-derived extracellular vesicles (EVs). EVs analysis in vivo are challenging, therefore we used a genetic model to analyze the extracellular compartment as well as the cell composition in vivo, which provided advantageous by focusing only on the relative changes between control and transgenic cells. With an improved protocol we isolated EVs from CT and β-catΔex3 hearts. The fraction containing small EVs was confirmed by electron microscopy and nanoparticle-tracking-analysis and further characterized with EV, endoplasmic reticulum and Golgi markers as well as mass spectrometry analysis. This analysis confirmed the cardiac origin of EVs and showed 47% proteins included in Exocarta Top100 candidate with a major exosome (Exo) representation. By proteomic analysis, 391 significantly differentially enriched proteins in β-catΔex3 hearts were identified, which were significantly loaded with all seven α and β chains of the constitute 20S proteasome, molecular chaperones and co-chaperones as well as proteasome associated proteins previously described in Exo (HSPA70, HSP90AB1, CRYAB, PKACA and BAG2). CRYAB, a cardiac chaperone protein that triages misfolded proteins for proteasomal degradation or repair, was confirmed to co-localize with labelled Exo in vitro. We performed single whole cell transcriptome, followed by pairwise comparison of differential expressed gene analysis (DEG) and their functional enrichment between β-catΔex3 and CT cell clusters. This revealed that different cardiomyocytes and endothelial cell subpopulations of β-catΔex3 CM were significantly active transcriptional activity of EVs secretion and protein quality control pathways. This finding was confirmed in cardiomyocytes populations of old mice subjected to experimental pressure overload to induce hypertrophy at early and late stages of remodeling, including an acute early upregulation of exosome biogenesis processes and chaperons transcripts including CRYAB at early stages. In order to model this molecular mechanism in human cells, human induced pluripotent stem cells (IPSC)-derived cardiomyocytes were subjected to pharmacological Wnt activation, which recapitulated the increased cell cycle activation as well as exosomal markers in vitro. Our results indicate a contribution of Exo-mediated maintenance of cardiomyocytes proteostasis upon pathological remodeling. Upon stress, CRYAB and co-chaperones increase binding to damaged-sarcomeric-proteins heading towards degradation, which overload the intracellular proteasomal capacity. This may activate EV-mediated cellular extrusion of misfolded proteins as a mechanism of cellular protection. Cardiac extracellular proteosome may serve as read-out of disease progression and for monitoring cellular remodeling in vivo.
2023-03-11 | PXD031113 | Pride