Genome-wide mapping of uncapped and cleaved transcripts (GMUCT) and transcriptome of DCLs
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
PROVIDER: GSE71803 | GEO | 2023/12/31
REPOSITORIES: GEO
Similar Datasets
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE. GMUCT libraries were made from flower buds of the Arabidopsis thaliana accession Columbia (Col-0) and three human cell lines—the cervical cancer cell line HeLa, human embryonic kidney 293 T (HEK293T) cell line, and the human chronic myelogenous leukaemia cell line K562—two replicates of each. Matched mRNA-seq libraries were made for each Col-0 GMUCT replicate. These libraries were sequenced on the Illumina HiSeq 2000 and the reads were trimmed to remove the adapter sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCA). The abundance of each unique read was determined, and unique reads were mapped to the Arabidopsis and human genomes, respectively.
2014-03-08 | E-GEOD-47121 | biostudies-arrayexpress
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE.
2014-03-08 | GSE47121 | GEO
Project description:We were interested in identifying targets of novel putative miRNAs we identified from small RNA sequencing libraries of Arabidopsis shoots. The small RNA (smRNA) sequencing libraries were made to identify changes in abundance of specific smRNAs in response to developmental transitions in Arabidopsis thaliana shoots, with special focus on vegetative phase change. We specifically wanted to separate the temporal changes in gene expression that result from vegetative phase change and those from flowering. Because of the close timing between the juvenile-to-adult and adult-to-reproductive developmental transitions in Arabidopsis grown under long day conditions, we used the late-flowering genotype FRI;FLC developed by the lab of Richard Amasino by introgressing the FRI allele from Sf-2 into the Col-0 genetic background, which is fri;FLC. For the early flowering genotype, we used FRI;flc-3, also developed by the Amasino lab by EMS-mutagenizing FRI;FLC, identifying early flowering mutants, and backcrossing multiple times to eliminate other EMS-induced mutations. The onset of vegetative phase change in FRI;FLC and FRI;flc-3 under our growth conditions was identical, but the progression was slower in FRI;FLC. By sequencing small RNAs from shoot apices at different time points and fully-expanded leaves at different positions on the shoot and comparing the results between the two genotypes, we were able to obtain a clear picture of changes in small RNA abundance in response to vegetative phase change and flowering in Arabidopsis. We then used the remaining RNA to make genome-wide mapping of uncapped and cleaved transcripts (GMUCT) 2.0 libraries of a subset of our samples. GMUCT 2.0 allows you to identify RNAs that are 1) uncapped and in the process of 5’->3’ exonuclease degradation and 2) miRNA and siRNA-mediated cleavage products. We wanted to use these GMUCT 2.0 libraries to identify targets of novel putative miRNAs discovered by our smRNA sequencing, thereby supporting the idea that these novel putative miRNAs are in fact functional.
2016-02-01 | GSE72505 | GEO
Project description:Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0
| PRJNA203678 | ENA
Project description:RNA turnover is necessary for controlling proper mRNA levels post-transcriptionally. In general, RNA degradation is via exoribonucleases that degrade RNA either from the 5’ end to the 3’ end, such as XRN4, or in the opposite direction by the multi-subunit exosome complex. Here, we use genome-wide mapping of uncapped and cleaved transcripts to reveal the global landscape of co-translational mRNA decay in the Arabidopsis thaliana transcriptome. We found that this process leaves a clear three nucleotide periodicity in open reading frames. This pattern of co-translational degradation is especially evident near the ends of open reading frames, where we observe accumulation of cleavage events focused 16 to 17 nucleotides upstream of the stop codon because of ribosomal pausing during translation termination. Following treatment of Arabidopsis plants with the translation inhibitor cycloheximide, cleavage events accumulate 13 to 14 nucleotides upstream of the start codon where initiating ribosomes have been stalled with these sequences in their P site. Further analysis in xrn4 mutant plants indicates that co-translational RNA decay is XRN4-dependent. Additionally, studies in plants lacking CAP-BINDING PROTEIN80/ABA HYPERSENSITIVE1, the largest subunit of the nuclear mRNA cap-binding complex, reveal a role for this protein in co-translational decay. In total, our results demonstrate the global prevalence and features of co-translational RNA decay in a plant transcriptome.
2016-09-30 | GSE71913 | GEO
Project description:A battery of spliceosome-associated proteins has been identified in microRNA (miRNA) biogenesis; however, the underlying mechanisms remain elusive. The intron lariat spliceosome (ILS) complex is highly conserved among eukaryotes and its disassembly marks the end of a canonical splicing cycle. In this study, we show that two conserved disassembly factors of the ILS complex, ILP1 and NTR1, positively regulate microRNA biogenesis through facilitating transcriptional elongation in Arabidopsis. ILP1 and NTR1 form a stable complex and co-regulate alternative splicing of more than a hundred genes across the genome including the core circadian gene LHY and some pri-miRNAs. Dysfunction in either ILP1 or NTR1 result in reduced RNA polymerase II occupancy at elongated regions of MIR chromatins, without affecting MIR promoter activity, pri-miRNA decay and DCL1 processing. Our results provide insights into the molecular mechanisms of spliceosomal machineries in non-coding RNA regulation.
2019-11-12 | PXD011542 | Pride
Project description:Various messenger RNA (mRNA) decay mechanisms play major roles in controlling mRNA quality and quantity in eukaryotic organisms under different conditions. While it is known that the recently discovered co-translational mRNA decay (CTRD), the mechanism that allows mRNAs to be degraded while still being actively translated, is prevalent in yeast, human, and various angiosperms, the regulation of this decay mechanism is less well studied. Moreover, it is still unclear whether this decay mechanism plays any roles in regulation of specific physiological processes in eukaryotes. Here, by re-analyzing the publicly available polysome profiling or ribosome footprinting and degradome sequencing datasets, we discovered that highly translated mRNAs tend to have lower co-translational decay levels. Based on this finding, we then identified Pelota and Hbs1, the translation-related ribosome rescue factors, as suppressors of co-translational mRNA decay in Arabidopsis. Furthermore, we found that Pelota and Hbs1 null mutants have lower germination rates compared to the wild type plants, implying that proper regulation of co-translational mRNA decay is essential for normal developmental processes. In total, our study provides further insights into the regulation of CTRD in Arabidopsis and demonstrates that this decay mechanism does play important roles in Arabidopsis physiological processes.
2023-12-31 | GSE247329 | GEO
Project description:Posttranscriptional repression by microRNA (miRNA) occurs through transcript destabilization or translation inhibition. Whereas RNA degradation explains most miRNA-dependent repression, transcript decay occurs co-translationally, raising questions regarding the requirement of target translation to miRNA-dependent transcript destabilization. To assess the contribution of translation to miRNA-mediated RNA destabilization, we decoupled these two molecular processes by dissecting the impact of miRNA loss of function on cytosolic long noncoding RNAs (lncRNAs). We show, that despite interacting with miRNA loaded RNA-induced silencing complex (miRISC), the steady state abundance and degradation rates of these endogenously expressed non-translated transcripts are minimally impacted by miRNA loss. To validate the requirement of translation to miRNA-dependent decay, we fused a miRISC bound lncRNA, whose levels are unaffected by miRNAs, to the 3’end of a protein-coding gene reporter and shown that this results in its miRNA-dependent transcript destabilization. Furthermore, analysis of the few lncRNAs whose levels are regulated by miRNAs revealed these tend to associate with translating ribosomes and are likely misannotated micropeptides, further substantiating the necessity of target translation to miRNA-dependent transcript decay. Our analyses revealed the strict requirement of translation for miRNA-dependent transcript destabilization and demonstrates that the levels of coding and noncoding transcripts are differently affected by miRNAs.
2020-01-09 | GSE143277 | GEO
Project description:DICER-LIKE1 (DCL1) is required for miRNA biogenesis and embryonic pattern formation. Presumably the patterning defects observed in dcl1-5 null embryos are due to the loss of miRNAs and the consequent up-regulation of their respective targets. To test which miRNA targets were up-regulated in dcl1 embryos relative to wild-type embryos, we performed genome-wide transcript profiling of wild-type and dcl1-5 early globular embryos using directional mRNA-Seq.
2010-12-01 | GSE25404 | GEO
Project description:In plants, DICER-LIKE1 is a critical enzyme in the biogenesis pathway of plant miRNAs. Zinc-finger nucleases were used to generate single and double-mutants of soybean DCL1 homologs. We created several small RNA libraries to investigate the effect on miRNA abundance in these various mutants. RNAseq transcript data was also generated in order to investigate targets of those impacted miRNAs.
2016-03-04 | GSE76036 | GEO