The effect of RPN9 silencing in N. benthamiana
Ontology highlight
ABSTRACT:
ORGANISM(S): Nicotiana benthamiana Solanum tuberosum
PROVIDER: GSE8259 | GEO | 2007/09/01
SECONDARY ACCESSION(S): PRJNA101213
REPOSITORIES: GEO
Similar Datasets
Project description:N. benthamiana plants were grown under 16 hour light/8 hour dark cycle in a plant growth room at 24°C for approximately six weeks before subjected to virus-induced gene silencing. Agrobacterium stain GV2260 (OD600=1.0) carrying silencing constructs were infiltrated into 2 fully expended leaves for inducing gene silencing. Samples were collected at 8, 10, 12, 14, and 16 days post Agro-inoculation (DPI) for RPN9-silenced plants and N-silenced control. For RPN8-silencing, samples were collected at 8, 10, and 12 DPI, and the empty vector treated plants were used as a control. Each sample was a pool of 6 silenced leaves collected from 3 individual plants. All the samples were in biological triplicates from 3 sets of independently silenced plants. Total RNA was extracted using Trizol and DNA was removed with DNase I treatment before cDNA synthesis. Keywords: Reference design 25 hybs total
2007-09-01 | E-GEOD-8259 | biostudies-arrayexpress
Project description:Tomato seeds (S. lycopersicum ‘Fl Lanai’) were germinated under greenhouse conditions maintained at 24°C-29°C in flat trays (BWI Apopka, Catalog Number GPPF72S7X) filled with Sungro Horticulture soil (Metro-mix 830, BWI Apopka, Cat# TX830). Two weeks post emergence seedlings were transplanted to 4” pots using the same soil and transferred to a Conviron walk-in growth chamber (CMP6060) for the remainder of the experiment. Conviron conditions include a 14h/10h light/dark cycle maintained at 28°C, and plants were fertilized weekly (20-20-20). To prevent cross contamination, tomato plants were confined to insect proof cages at all times (BioQuip 1450NS68). Four weeks after transplanting, 40 whiteflies (B. tabaci MEAM1) were collected from virus free or Tomato Mottle Virus (ToMoV) established colonies via aspiration and moved into a clip cage placed on the 4th true leaf of each tomato plant as previously described38. Whiteflies were reared cabbage (Brassica oleracea), while viruliferous whiteflies were reared on ToMoV infected tomato from colonies established in the Polston lab. For all plants in this study, feeding was halted after 3 days of whitefly feeding (3 DPI) by gentle removal of clip cages and whitefly termination using insecticidal soap (Garden Safe, 1% of potassium salts of fatty acids). For the samples referred to as “local”, the tomato leaf bound within the clip cages was immediately removed and snap frozen for protein extraction. For the samples designated “systemic”, the plants were allowed to continue growing for 7 additional days after clip cage removal and whitefly termination, at which point the 9th leaf was excised and snap frozen. Plants used for collection of local leaves at 3 DPI were not used for the collection of systemic leaves 10 DPI. For both local and systemic leaves collected, we also included a no treatment control (NTC) that was subjected identically to clip cage and insecticidal soap applications, but without the addition of whitefly or ToMoV. Our experiment therefore consists of a no-treatment control (NTC), a whitefly treatment (+WF), and a viruliferous whitefly (+WFV) treatment for both local (4th true leaf, 3 DPI) and systemic leaves (9th true leaf, 10 DPI). The presence of ToMoV in all infected plants was confirmed via Nanopore sequencing. Briefly, Tomato genomic DNA was extracted from five systemic leaf samples using the PureGene tissue DNA isolation kit (product # 158667; QIAGEN, Valencia, CA, USA), following the manufacturer’s protocol and stored at -80°C until needed. Library preparation was performed using the Rapid Sequencing Kit RBK004 protocol (Oxford Nanopore Technologies) and loaded onto a 9.4.1 flow cell in a MinION connected to a MinIT with live base calling enabled. Resulting sequencing reads for each sample were mapped to both ToMoV A component (GenBank accession: L14460) and ToMoV B component (GenBank accession: L14461) sequences.
2020-10-02 | PXD019197 | Pride
Project description:LapA encodes an acidic leucine aminopeptidase that is wound-inducible and found only in tomato (Solanum lycopersicum) and a small subset of the Solanaceae. LapA is expressed in developing flowers, fruit and in foliage after wounding, insect feeding (Manduca sexta), Pseudomonas syringae pv. tomato infection, salinity, and water-deficit stress. Using Agrobacterium tumefaciens, UC82b plants were transformed with a chimeric gene containing the CaMV 35S promoter and LapA cDNA in the sense orientation. Kanamycin-resistant plants were screened by RNA and protein blots to identify plants that did not accumulate and LAP-A protein upon wounding; these plants were designated LapA-silenced (LapA-SI) lines. The LapA-SI plants have an impaired wound response and do not accumulate wound response transcripts (proteinase inhibitors and polyphenol oxidase) to wild-type levels. LAP-A is the first aminopeptidase to be shown to have a regulatory role in plants. LapA-SI and UC82b plants were germinated on filter paper for 7 days before being planted in soil. Plants were grown in a growth chamber, (16 hour days at 28°C, 8 hour nights at 24°C, 50% humidity) for three weeks. Plants were wounded by crushing each leaflet on each of two lower leaves with pliers. Wounded leaves were collected at 0, 1 and 8 hr (local wounded tissue). Two upper, unwounded leaves were collected from the same plants at the same times (systemically wounded tissue). Five to seven plants were pooled for each time point. The experiment was repeated three times. RNA was extracted using a hot phenol/LiCl protocol and purified and DNase treated using the SV Total RNA Isolation Kit from Promega. Keywords: Reference design
2007-09-01 | GSE8236 | GEO
Project description:Potato cultivar Russet Norkotah was grown in a growth chamber at 16 hour light/8 hour dark at 22°C fertilized with Osmocote. Plants were from tissue culture, transplanted to soil and used approximately 4 weeks after transplanting. RNA was extracted from leaves using Trizol. Plants were sprayed with one of four treatments, either 1mM salicylic acid, 100 µM methyl jasmonate, 1 mg/ml arachidonic acid or 100 µM methyl jasmonate plus 1 mM salicylic acid together. Samples were harvested at 3, 24 and 72 hours after spraying. Each salicylic acid or arachidonic acid treatment has 3 biological replicates done in parallel, using leaves pooled from 2 plants. The control for SA or AA treated plants were water sprayed plants, from which leaves of 3 different plants were pooled at each timepoint, done side-by-side with the treated samples. Methyl jasmonate or MJ+SA treatments had 2 biological replicates each, using leaves pooled from 2 plants. A separate set of water sprayed plants (from the SA and AA control treatments) were used as controls, and pooled leaves from 3 plants were used at each time-point, and done in parallel with the treated samples. Keywords: Direct comparison
2007-09-01 | GSE8208 | GEO
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:The 35S::GFP fluorescence was silenced 6-day after infiltration to Nicotiana benthamiana leaves due to the post-transcriptional gene silencing, but became stable by adding the viral suppressor 2b which repressed RNA silencing in plants. We performed the small RNA high throughput sequencing to test whether WUS can inhibit 2b functions in repressing plant RNA silencing.
2021-02-22 | GSE128863 | GEO
Project description:DICER-like proteins produce small RNAs that silence genes involved in development and defenses against viruses and pathogens. Which DCLs participate in plant-herbivore interactions remains unstudied. We identified four distinct DCL genes and stably silenced their expression by RNAi in Nicotiana attenuata, a model system for the study of plant-herbivore interactions. Silencing DCL1 expression was lethal to the plants. Manduca sexta larvae performed significantly better on ir-dcl3and ir-dcl4 plants, but not on ir-dcl2 plants compared to wild type plants. Phytohormones, defense metabolites and microarray analyses revealed that when DCL3 and DCL4 were silenced separately, herbivore resistance traits were regulated in distinctly different ways. Crossing of the lines revealed complex interactions in the patterns of regulation. Single ir-dcl4 and double ir-dcl2/ ir-dcl3 plants were impaired in JA accumulation, while JA-Ile was increased in ir-dcl3 plants. Ir-dcl3 and ir-dcl4 plants were impaired in nicotine accumulation; silencing DCL2 in combination with either DCL3 or DCL4 restored nicotine levels to those of WT. Trypsin proteinase inhibitor activity and transcripts were only silenced in ir-dcl3 plants. We conclude that DCL2/3/4 interact in a complex manner to regulate anti-herbivore defenses and that these interactions significantly complicate the already challenging task of understanding smRNA function in the regulation of biotic interactions. Gene expression in leaves of Nicotiana attenuata wild type, irDCL3 and irDCL4 plants was measured at 1 hour after elicitation with oral secretions of Manduca sexta larvae. Three independent experiments were performed with wild type plants and three independent experiments were performed with irDCL3 and irDCL4 plants. A total of 811 genes were identified as differentially regulated in irDCL3 and irDCL4 compared to wild type plants.
2013-12-24 | E-GEOD-30124 | biostudies-arrayexpress
Project description:In the present study molecular interactions between potato plants, Colorado potato beetle (CPB) larvae and Potato virus YNTN (PVYNTN) were investigated by analyzing gene expression in potato leaves. mRNA samples of secondary PVYNTN-infected (CPB_PVY) and healthy potato plants (CPB_H) cultivar Igor and of RNAi coi1-silenced (CPB_coi1) and non-transformed (CPB_NT) potato plants cultivar Desiree collected 24 h post CPB infestation and respective control non-infested samples (CONT_PVY, CONT_H, CONT_coi1, CONT_NT).
2014-10-23 | E-GEOD-56333 | biostudies-arrayexpress
Project description:Deoxyhypusine synthase (DHS) is encoded by a nuclear gene and is the key enzyme involved in the post-translational activation of the eukaryotic translation initiation factor eIF5A. DHS plays important roles in plant growth and development. To gain a better understanding of DHS, the petunia (Petunia hybrida) PhDHS gene was isolated, and the role of PhDHS in plant growth was analysed. PhDHS protein was localized to the nucleus and cytoplasm. Virus-mediated PhDHS silencing caused a sectored chlorotic leaf phenotype. The chlorophyll levels was reducted and the development of chloroplasts was abnormal in PhDHS-silenced leaves These features were not observed in DHS-suppressed Arabidopsis thaliana and Solanum lycopersicum. These results indicated that PhDHS is required for development in petunia. A proteome assay showed that 308 proteins are up-regulated and 266 proteins are down-regulated in PhDHS-silenced plants compared with control. Among them, 20 proteins in photosystem I and photosystem II and 11 thylakoid proteins were down-regulated in PhDHS-silenced leaves, further supporting the involvement of PhDHS in photosynthesis in petunia.
2019-11-13 | PXD012227 | Pride
Project description:Virus resistances that are recessively inherited are associated with loss-of-susceptibility resistance alleles. Resistance to Watermelon mosaic virus (WMV) of melon accession TGR-1551 is expressed as a drastic reduction of the virus titer, and is recessively inherited. In this work, viral RNA accumulation was measured in TGR-1551 and in susceptible WMV-infected melon plants by real time quantitative PCR (qPCR), and gene expression of 17,443 unigenes represented in a melon microarray was monitored in a time-course experiment. Virus accumulation was higher in inoculated cotyledons of the resistant genotype up to 7 days post-inoculation; from this time on, virus accumulation was much higher in plants of the susceptible genotype. Microarray experiments were carried with samples from inoculated cotyledons at 1 and 3 dpi to monitor early changes in response to virus infection, and at 7 dpi. Samples from systemically infected leaves harvested at 15 dpi were also included in the analysis. Results showed much more profound transcriptomic alterations in resistant plants compared to susceptible ones. Analyses of gene expression profiles reveal deep and extensive transcriptomic alterations in TGR-1551 plants, many of them involving pathogen response-related genes. Overall, data suggested that resistance to WMV in TGR-1551 is associated with a defense response, contrasting with its recessive nature. Two melon genotypes have been used to analyse transcriptomic responses to infection by Watermelon mosaic virus: Tendral (susceptibel to WMV) and TGR-1551 (resistant to WMV). For each genotype, 60 melon seedlings were inoculated with WMV-M116 and another 60 were mock-inoculated. Cotyledons of 10 plants were harvested at 1, 3, 5, 7, 9 and 15 dpi. At 15 dpi, the systemically infected second true leaf was also harvested. To reduce variability, each biological replicate used in this study was prepared by mixing the RNA extracts from 2 or 4 mock or WMV-inoculated cotyledons, respectively, or from 3 melon leaves. Samples (WMV infected and mock inoculated) corresponding to cotyledons at 1, 3 and 7 dpi, and leaves at 15 dpi were used for microarray hybridisations, three biological replicates for each one, leading to a total of 48 samples.
2011-10-02 | E-GEOD-30111 | biostudies-arrayexpress